Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig61
Contig Information
Length 639 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n12l21    rwhv3n12l21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0568500 [Oryza sativa (japonica cultivar-group)] >gi|12583793|gb|AAG59645.1|AC084319_3 hypothetical protein [Oryza sativa] >gi|108709382|gb|ABF97177.1| Uncharacterised protein family containing protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113548981|dbj|BAF12424.1| Os03g0568500 [Oryza sativa (japonica cultivar-group)] >gi|215765149|dbj|BAG86846.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218193170|gb|EEC75597.1| hypothetical protein OsI_12299 [Oryza sativa Indica Group]
Score 286
Evalue 4.299e-24
Total Hit Count 65
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig61
GGAAGAAGAAGAAAAGGCAAAGGCCTCCAAGATCTCGGCTCCGAGAGAGATCTGAGAGAGAGGTGCTTCGGAGATGCACGACTTCTGCTTCACGATCCCC
TACGGGTTCGCGGTCCTGGCCGGCGGCCTGCTGGGCTACCTCCGCCGCGGCAGCACCGCCTCACTGGCGGGCGGCGCCGGCGTGGGCGGGCTTCTCCTCC
TGGCAGGGTTCGTCAGCCTCAAGGCCTTCGAGAAGCGCCGCAACTCCTACCTCGCCCTCGCACTCGAGACCCTTTGCGCACTGGCCTTGACCTTTGTTAT
GGGGCAAAGATACCTTGAAACTTCAAAGATAATGCCGGCTGGTGTCGTTGCTGGCCTCAGTGCTCTGATGTCGGCATTCTATCTGTTCAAAATTGCTACC
GGCGGCAACCATTTCTCGCCAAAGAAAGAGTAGGCCAGACGTTGCTTGGCCAAACCCAAAGACCATATGGCATATTGTGTTCTGCATTCGAATTGTAACT
TGACTGATGTTCTATGTTGTGCTTGCACCTTTGCTCAAATGTTTTGTATGTGGANCCTGGAAAGGTATTCAGCCATGTAAATGAATCTAACATTTCAATT
GTGCTTCGTTGAAGGCGCAAACTTGTCCTTAGGTTGCCT
page-top