Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig59
Contig Information
Length 824 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n2p14    rwhv3n2p14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit wpk4 protein kinase [Triticum aestivum]
Score 709
Evalue 6.39306e-73
Total Hit Count 351
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig59
CCGGGGCCACTCCCACGCCCCGCAAGCCTTAACGCGTTTGATATCATATCATTCTCAAGGGGATTCAACTTGTCGGGGCTGTTTGAGGAAAAAGGGGACG
AGGTGAGATTCATCTCGAGTGAACCTATGTCGGGCATTATAACGAAATTAGAGGAGATCGCAAATGTGAAGAGCTTCGCGGTGCGGAAGAAGGATTGGCG
GGTGAGCCTAGAGGGCACAAGGGAAGGGGTTAAGGGGCCACTAACAATCTGCGCGGAGATATTTGAACTCACACCCTCCCTTGTAGTAGTGGAGGTAAAA
AAGAAGGCGGGGGATAAGGAAGAGTATGATGATTTCTGCAACAAGGAATTGAAGCCAGGAATGCAGCATCTTGTGCACCAGATGGCCCCAGTTCCAATTA
CACCTACCATTTCTGAGTAGGCCGAAAGGCCTTCAAGGTAACAGGCGCCACCGCCCCTAGAGCTAACGGGGATAGGGGGAGCGACTCTCCAAGCTAGAAA
GAAACTGGAGTCGGGTGCAACTGACAGGAGCAAGAGTTCTTGTAGTCTCGGGCACTGACGATGATGAGCGCGGTTACTTGGTTAACTCTGGAGAGCATAC
GTAATGTTATCCGAGACGGGAGCTAGATTGTGGCTGTATATGGTGTCACCCTAGCTGCTGTTTAAATGTTTGTACTTTTCTCTACTTAATTTGCTGATGA
TGATTGTGTATGTACTCCCGCTGTTGGTTTATCAGCAGAACCGAATAATTTTGGGTAATCGTTAATTCAAGGACCAAACTGATTGAGGAATAAATTGGGT
GCAACATGCATTGCATGCACCCTT
page-top