Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig58
Contig Information
Length 791 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n12l15    rwhv3n12l15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_36525 [Oryza sativa Indica Group]
Score 555
Evalue 1.86356e-73
Total Hit Count 176
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig58
AACAACTGGGGGACAGGAAAAAGAGGCTGTTTGCAAGCGTTGATTCCGGTTGCAATGGTTGCATCTTCATTCAAATGCACAAAAGAGATGGAGACCCTGG
TCCAGTTGAGATTGTACAAAGCATGATGTCTTCGGCTGCTTCAACTCGCTAAACATATGTCCAGGTTTATTCTGAGGGTGTTGCCTGCTGAGGTGGTATG
TTATGCTTCAGAAGAGGAAATAACAAGAGCCATTGCTCCACTTGTTGAAAAGTACTTCCCCAAAGAATCTCCTTCGGGACATAAGTTTGCTGTGTTATAC
GAAGCAAGGTCAAACACAGGAATCGATAGAATGAAAATTATAAATGCAGTTGCAAAATCTATACCTCAACCTCACAAAGTTGACCTCAGCAACCCCGACA
AGACTATTATTGTCCAGATTGCCAAGACTATATGCATGATTGGAGTGGTGGAGAGATACAAAGAGCTTTCGAAGTTCAACCTAAGGCAGCTGACCTCACC
ACCGGAGAAGTAGTTTCTGCGTGAGAAATTCTTCCTCCTGGTTGAGTTTTAATCATATGCGGTAACTAGCTACTGTGAAAGTCATTGCCAAATGATTCAG
ATGTATTATGTCGTTAAAAAGCATGGTCATTGACGTGTGGATGCATCCTGGATTGCTTGCTTAATGCCGTATGGTGCAATTTTGGAACCTGTTGAATTTC
CTACTACAGCAATCGTTGGAATAAAGGGTTAATTAGATTCATGCAACTGTAACTTTGGTGAGTTGGAAAATATACATTTACAAAAAAAAAA
page-top