Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig54
Contig Information
Length 729 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n12k14    rwhv3n12k14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0629500 [Oryza sativa (japonica cultivar-group)] >gi|113565539|dbj|BAF15882.1| Os04g0629500 [Oryza sativa (japonica cultivar-group)] >gi|125549854|gb|EAY95676.1| hypothetical protein OsI_17541 [Oryza sativa Indica Group] >gi|125591733|gb|EAZ32083.1| hypothetical protein OsJ_015566 [Oryza sativa (japonica cultivar-group)] >gi|215678928|dbj|BAG96358.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215706303|dbj|BAG93159.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215768259|dbj|BAH00488.1| unnamed protein product [Oryza sativa Japonica Group]
Score 399
Evalue 4.4922e-37
Total Hit Count 390
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig54
ACTTCCTTCCTTGCCTTTTCTCTCTCGGGGCAGACAGGCTGTGATTTTCTTCTTGTTGTTGTTCTCCTTGCCGGAGAAGGAGGAGGAAGAGGAGATAGAC
TAGGGAGGCGGCGGCATGGACGCGGAGATCCAGCGGCCGCGGGAGGTGGGCAGCTGCAGGGTGGTCAAGGTGGACAAGGAGGCCGCCTGGGACCTCTTCA
CCACCCAGGCCGCCAACGAAGGCCGCACTGTCGCTGCTCACTTTGGGGCGTCTTGGTGCGTCACGTCCCTGTCCATGAACTACAAGTTCGAGGAGCTCGC
CCAGACCCACCCCGACATGCTCTTCCTCTTCGTCGACGTCGATGATGTCCCGGGCGTGTCTTCCAAGCTGGGGGTGAAGGCCATGCCCACCTTCTTCCTC
ATCAAGGGCAAGGAGGTGGTGAAGAAGATCGTCGGCGCCAACTCGGACGAGCTCCACAAGATGGTGGACGCCTCCGACGACGATTCGCTCGGCTCCGCTG
TCACCACTCTCCCTGACATAGTCATCGAAAAATAGCCGTTTTGCCGTCTCTGAATCTTCTCCGAGTGCTGTTCGCTTGGTTCCGGTGTGTGTGTGACTCT
GAATCTTATCTGATCTGATCTGATGTGTGTGCCCCTTCCCGCTAGAGGAGAGTAGGGCGTGTGACTTGGCTGCTGGTTAAGGTTATTAATTGTTGTCGAT
TAGTGCATGCGTGTGTTCTGTTTTTGGGT
page-top