Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig52
Contig Information
Length 784 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n12k03    rwhv3n12k03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0425200 [Oryza sativa (japonica cultivar-group)] >gi|37572930|dbj|BAC98560.1| unknown protein [Oryza sativa Japonica Group] >gi|113623806|dbj|BAF23751.1| Os08g0425200 [Oryza sativa (japonica cultivar-group)] >gi|125561599|gb|EAZ07047.1| hypothetical protein OsI_29294 [Oryza sativa Indica Group] >gi|125603465|gb|EAZ42790.1| hypothetical protein OsJ_026273 [Oryza sativa (japonica cultivar-group)] >gi|215704566|dbj|BAG94199.1| unnamed protein product [Oryza sativa Japonica Group]
Score 631
Evalue 6.51249e-64
Total Hit Count 84
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig52
ATGGTGTCCTCTCGCTGCGCCGTCCTGCCCCACCCTGCCGGAGTGGCCCCTCGTCGCCGGCAACACCTACCCGCACAGGCGTTCTGGGGGACGGAGAGGA
GGCGGCGGCGGCGGCTCGTGAGCTTCGAGGCGCCGCCTCGGTGCCACAAGATGTATGTTCCCGGCTTTGGAGAGGGCTCACCAGAGAAAAAGGCGGCGAT
TAGTCTGCTGAACTTCTTCAATTACCTGGCCGTCAGGATTGTGCTGGCACAGCTTGAGAGTTACAACCGAGAAGCCTATGTTGAGCTCAAGGAGTTCACC
AGCCGCAACTCCGTGAACGACGCTGATAGTTTCTGCAAAAACCTGATCCGCGAGTCGCCAAGACACAAGGCATTAGCTATGAGGATTTTGGAGGTTCGAT
CGGCTTATATGAAGAATGATTTCGAGTGGGACAACCTGAAGAAGCTATCGTTCAAGATGGTTGATGAAGCCAACATAAAGCTCATGAGGGATTATGTCCT
GGAGACCAGCCACATAGAAGACGACGAGTGAAGATATCACATGTATCCTCGGCACGTCCGCCGTGCAGGCCTCGATCGATCGACAGCTCTGCACACGCAC
ATGATTTGATTATGTTCTTTATTACCAAGTGCAGTTCAAACTCCGTGTATTTGGGACTGGAAATGATCAGACAACATGACGATGCGCGCTAATGGGTTAT
ACCACGCTGAAACTGAACCAGTGGTTAGGTCATATAGATATCACGGTCTCAGAGGTTGCTTATACGACATCCTGAATCAAGTAT
page-top