Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig50
Contig Information
Length 644 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n12j24    rwhv3n12j24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 624
Evalue 2.82078e-63
Total Hit Count 136
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig50
ATCGAGCTAGGATTGAACAGAGGAGGGGAGGAAGAAGCTTAGGGGGTGCCGGCCATGGCGAGCCTGATGGACAAGGCCAAGGGGTTCGTCGCCGACAAGA
TCGCGCACATGCCCAAGCCGGAGGCGTCGCTGGACAAGGTGACCTTCAAGGGCATGACCCGCGAGGCCATCACCGTGCACAGCCACGTCAACGTCACCAA
CCCCTACTCCCACCGCATCCCCATCTGCGACATCGCCTTCAACCTCAAGTGCGGCGGCAAGGAGGTGGCGAGCGGCACGATCCCGGACCCGGGCTGGATC
GAGGACAGCGGCGAGGTCACCAAGCTGGAGGTGCCGGCCAAGGTGCCCTACGACTTCCTCATCTCTCTCATGAAGGATCTGGGCAGGGACTGGGACATCG
ACTACGAACTCCTCGTCAAGCTCACCATCGACCTCCCCATCATCGGCAACTTCACCATCCCGCTCGAAACCGCCGGCGAGTTCAAGCTGCCCACCCTCAG
CGACTTCTTCGGCGGCGCCGCCAAGACCGAGGAGGCCACCGCCTAGCCATAAGCTCGATCTAGCTCGCAGCTTGCTCTGCATCCGCATGCCTGTACTCTA
CCGTTGCCGCAATAATGAGAGCAAATATTTTCGGAAAAAAAAAA
page-top