Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig48
Contig Information
Length 785 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n3c06    rwhv3n3c06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_010652 [Oryza sativa (japonica cultivar-group)]
Score 607
Evalue 3.95099e-61
Total Hit Count 191
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig48
CCCATCCTGGACGACGAGATCAACGAGGCCATCGTCCGCCCGCTGGTGCACGGCGTCAAGCTCCACGCCATCGTCGACGCCTGCCACAGCGCCACCGTCC
TCGACCTCCCCTACCAATGCACCGTGTCCAAGCAGACCGGGCGCTGGAGGTGGAGGGACGAGCGCCCTATGACCGGCGCCTGCAAGGGCACCAGCGGAGG
CCAGGCCGTGCTCATCAGTGGCAGCAGCAACGGAAAGAGCAACATGAGCGTGCTGCCTGAGCCCTACGCCACGATCGGCGCCATGACGCACAGCTTCATC
AGAGCGGTGGAGTGCGAGCCGCGCACCACCTACGGCCGCCTGCTCACCTCCATGAGGGCCATTATGCGCGACAGCAGCGGCAACTGCAACCTGCAAGGCC
CCATCGGCGGCTCCATCCGCAAGGTCGCAAACTTCAGCGGCGTGGAGGAGCCTCAGCTGTCCTCTGCCTACAAGTTTGACGTCGAGCGCGAGCCGTTCTG
CATGTAGAACCCGACCAGCGAATTCGTCGTCACAGCGCTGCAGGCTACTGCACTCGACGATTACTACCTAATCATGCATCGACCGTACTGAATAATGGGC
CGGTTAATTAACTATGATGCTTGCTACTAGTATGTGTGACGATGTATCACATCACCTGCCGCCATGCCATCAAGAATGAGCACTGCATAGCTCATACAAA
GGCTCTGGAGGAACGTACCTCGTTCTCCACTCTACTGCACCTCACTGTAATATGGCCGTTGTGTGTCGTGTCGTCCCCTTAAATA
page-top