Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig47
Contig Information
Length 769 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n3d10    rwhv3n3d10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_38072 [Oryza sativa Indica Group]
Score 938
Evalue 1.57723e-99
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig47
GAAAAAAGGCCAGCCCGAGGGTGCTCTTTACGATTATGAGGACAAGATCAACTTTGCAGTGTTTCCGTCACTCCAGGGTGGCCCTCACAACCACCAGATT
GCTGCCCTGGCAGTTGGCCTGAAGCAGGCAATGTCACCTGGATTCAAGGCATATATTCAGCAGGTCAAGGCCAATGCTGTTGCCCTTGGAAACCAGCTGA
TGAGGAAGGGCTACAAGTTGGTTACGGATGGAACAGAGAACCACCTTGTTCTCTGGGATCTTCGCCCTCTTGGCTTGTCTGGCAACAAAGTTGAGAAAGT
ATGCGATCTGAGCAGCATTACACTCAACAAAAATGCCGTCTTTGGTGACAGCAGTGCATTGGCACCTGGTGGTGTCCGAATTGGTACACCTGCCATGACC
TCGAGAGGTTTGGTCGAGAAGGACTTTGTGAAGATTGCTGAGTACCTTCATCAGGCTGTGGTCATCTGCTTGAATGTCCAGAAGCAGCGAGGTAAGCGTT
ACAATGATTTCACCGTTGACTTGGAGAAGAACGAGGACATCGCGGAGCTCAGGGCAGAGGTGGAGAAGTTTGCCATTTCATTTGAGATGCCTGGCTTCCG
GGTGTCAGACATGAAATACAAGGATTAGGCTGTGGTACCATGCAGATCGTTTTCTTGTAGCAGCAAATTGGTGCCCTTAAGGGGTTGATTGCTGTGCGCT
AAGCGTGATGTATGAATTTATGGTTGAAAATGATATGACTCATGAATAATCATTGAAGGTATGCCATAG
page-top