Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig45
Contig Information
Length 1052 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n12g16    rwhv3n12g16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 955
Evalue 2.85339e-101
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig45
CGGCACCACTGTGATGTCACGAGCCATCTCATTCCCCAAGCTTGAGGTTTTGAAGCTAAGAAACATGAAGAATCTGGAAGACTGGTCCTTAAGTGTGGAA
GAGAGCCAGACATTGCTGCCTTGTCTCAAGTCACTGCACATACAGTTCTGCCCTAAACTCAAAGCTCTGCCAGAAGGTCTAAAGGACGCTGCTCTGTGCG
ACCTTCGTGTCGAGGGTGCACATTGCCTTACAGAGATAAAGGACCTGCCAAAACTATCTGATGAACTCTATCTGAAAGACAACAGGGCGCTTCTGAGGAT
CTCCAACCTACCCTCACTCAAGTCACTCACCATCGACGACTGCGCGAAGCTGAAGCACGTCTCGGGCCTCGACACGCTGCAGCATCTCAGGCTTGAGTTC
CCCCCATCCACGGAGACATACTATTTCGAGGAGTTGGTCACCTTCTGGAACATCGCATTCCCACGGTGGCTGGAGCTGCTGATCCGTTTGCAGGCCAATG
GCCTGCGTCGGTTCGAGCTGCAGTGTGCACTCCCTTTACTCAGGAGCTGCCTGGAGGGTGGGAAGAACTGGCACGTTGTGCAGCAGATCCCTGAGGTGCG
CATCACAAGCACCGATGGCAAGAAGTACATAAGGTACAACAAGGCCCGCCGCATCTACGAGACGAATGCTCAGTGTGAAGAGAAGTCTACCTAAAAATCT
TGGAGTACTTGGCAGCTGTTTGGTAGACATGTTTGGTCCGACCGTCCCTACTGCTCCAGGAGATGTCGTGGTTTACATCAGGGAGTCGTCGTGTTGTTAC
TAGAAATGGTTTGATGAGGCCTGAGGAATGAGTACCGTATTTTTGGTGAATCAGACAGCAGATGGTCTTTCCCCCCCTTCCTCAGTACTGAACTTGGCTT
AACTCCTTCACCAATACTCGATGTGTGATTCTTTTCCGTTTCCTGGTTCTGGCGATTTGTAAATTGTAAACATTGAGCTTGATGGATTTTGATGAGTGTA
AAGTATTGCCACTTGTGTACATGGATTTGTTTTTTTTCTTTTCGTGTCGGAA
page-top