Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig44
Contig Information
Length 706 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n3e21    rwhv3n3e21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit expressed protein [Oryza sativa (japonica cultivar-group)] >gi|108711117|gb|ABF98912.1| heavy metal-associated domain containing protein, expressed [Oryza sativa (japonica cultivar-group)]
Score 302
Evalue 7.44668e-26
Total Hit Count 113
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig44
AGTCTCCTCCGGATGAGGAGCAAGATAAGGTAGACAAAAATTCAGCCAGAGTCGTGGTCAGGGAGCTGCGTGCCGTGCAGAGATGCCGACCATCATCATC
AAGGTAGACCTCGACTGCGGCCGCTGCCACGCCAAGATCAGGAAGGTGCTCGAGAGGATCAGAGAGAAGGGCGAGTTCATCATCGACGACATCAAGTACG
ACGAGAAGAAGAACCACGTGATCGTGTCGGGCCCCTTCGACGCCGACAAGCTGGGCGACAAGCTCTGCTGCAAGGCCTGCAACATCATCAAGGAGATCGA
GACCGTCGAGCCGCCCAAGAAACAGGATCCCGAGCCTCCGCCGGCGACGGACAAGGTGAAGCCCCCGGGCCCGGGTAAGGATGAGACGGTCAAGGTGAAG
CAACAGCCGCCGCCGCCGCCGCCGCCGCCGCCCAAGATTGTGGAGGTGCCGGTGCCGTACCCGTGCCCCTACCCCTACCCGTTCCCGGCGGGGCCGTCCG
GCTGCTGCTGCCACCAGGGACACGGCGGTTGCCAGTGCTGGCAGAACCCTCCGCCGCCGTCGTATCCGTGCGGCGGCTACATGATGGTCTGCGAGGAGGA
CCCGTCCGGCGCCTGCACCGTCATGTGACTCCTCGGCAGCGTTATCACCGGTATTAGTGCGGTAATTCCTCATGTATAAGCACCGTACCGATGCGCATGT
ACGACC
page-top