Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig41
Contig Information
Length 926 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n11p09    rwhv3n11p09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Serine carboxypeptidase 3; AltName: Full=Serine carboxypeptidase III; AltName: Full=CP-MIII; Flags: Precursor >gi|1877219|emb|CAA70817.1| serine carboxypeptidase III, CP-MIII [Hordeum vulgare subsp. vulgare]
Score 1058
Evalue 4.53955e-142
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig41
CGATAAACTTGAAGGGATTTGCGATCGGTAATGGTCTCACAGATCCAGCAATCCAATACAAGGCCTACACAGACTATGCATTGGACATGAACCTTATTCA
GAAAGCTGACTATGAAAGGATCAACAAATTCATCCCACCATGTGAATTTGCAATCAAACTTTGTCGTACAGATGGGGAAAGCATCTTGCATGGCAGCATA
TATGGTCTGCAATTCCATCTTCAACTCTATCATGAAGCTTGTTGGTACCAAGAATTATTACGACGTTAGGAAGGAGTGCGAAGGGAAACTCTGCTACGAC
TTCTCAAACTTGGAGAAGTTCTTCGGTGATAAAGCAGTCAGACAGGCAATTGGAGTAGGTGACATTGAATTCGTCTCATGCAGCACTTCGGTTTATCAAG
CAATGCTCACAGACTGGATGAGGAACTTGGAAGTCGGCATCCCAGCTCTACTTGAGGATGGGATCAATGTGCTCATATATGCTGGGGAATATGACCTTAT
ATGCAATTGGCTCGGAAACTCAAGGTGGGTCCACTCCATGGAATGGTCTGGTCAGAAAGACTTTGCCAAAACTGCTGAATCATCGTTTTTAGTAGACGAT
GCCCAAGCTGGAGTCTTGAAGAGCCATGGGGCACTCAGCTTCCTCAAGGTTCACAATGCTGGCCACATGGTTCCGATGGACCAACCGAAGGCCGCCCTTG
AAATGCTGAGGAGATTCACCCAGGGGAAACTCAAGGAGGCGGTTCCTGAAGAAGAGTCATCGACGACCACGTTTTACGCCCGCGATGTGATCGTCAACAC
CGACCAAAAAGGGAAAAGAAACTGGCTAGGTAGCCTGCACGCGTCGCCCTTGCGGTCTCAAGGAGTGTCTGCTGTAGCTTCCTGTTTTCCATGTATCTTT
TTTCTCCGCTGTTTCAACTGGATATG
page-top