Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig40
Contig Information
Length 778 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n12i18    rwhv3n12i18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0401200 [Oryza sativa (japonica cultivar-group)] >gi|113579038|dbj|BAF17401.1| Os05g0401200 [Oryza sativa (japonica cultivar-group)] >gi|125552271|gb|EAY97980.1| hypothetical protein OsI_19899 [Oryza sativa Indica Group] >gi|125594183|gb|EAZ34242.1| hypothetical protein OsJ_017725 [Oryza sativa (japonica cultivar-group)]
Score 633
Evalue 3.75879e-64
Total Hit Count 71
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig40
TGCCGGGCATTTTGCTGGTATGAGGAGACAGGGCCGGAAGCAACACCGAAGCACACCAATAGTATCTCTGTTTGGGAGAAAGACCGCGAAGAAGACCACC
AGAGAAACGGTCGTCCCGGACCCAGACTATCGGTTACCGATCGCTATACTTGGGATATCTGGTGTGTTTGCATATGCAGACAATCTTCTTGCCGCTGCAC
CTGTAGGCCTACTGGGGCTGCTTCTCTTGTTTCAGACTACTAGAGTTAGGTTCGTCTTTGATGATGATTCCCTGGAAGTGAAAGTGGGCAATCAGCTGCA
GGAGTCAGGCGAAAACGTGTTTGTTGGTGGCAAGAACCGTTGGAAGTACTCAACATTTGTGAACTGGGAACTATGGTGGCCGCAATTTCCTATCCTAGTT
TACTTCAAAGAGACCCAAACAAAACCCGAAGGCCAAATTCATTTCTTCCCAGTGATTTTCAACGGCCGACAACTCTATGATATCATGGTGGAGCGCGCTG
GATCATCGGAAACAAGTGGGCCTGGTCCTTGAGACAGACAACGAGTTGTGCTAAGTTCCAGGAGCCAAAATGTCTTCACTAAGCGTGTTAACAGCCCTTG
AAAATCTCCATGAATGATTTGAAGAAACTACTTCAATGCATGTATTCTGTGTTTTGAAATATAGTATCCTACTCTTTGAAAACAAAAGATGTACAATAAG
CATGTTAAAATTGATACGTGAGATAATGATGTAAGAGCATCTCCAACAGAGTTGGTAAACTCATGTCCAATCCCTACG
page-top