Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig39
Contig Information
Length 474 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n12i15    rwhv3n12i15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0295000 [Oryza sativa (japonica cultivar-group)] >gi|113563968|dbj|BAF14311.1| Os04g0295000 [Oryza sativa (japonica cultivar-group)] >gi|215740456|dbj|BAG97112.1| unnamed protein product [Oryza sativa Japonica Group]
Score 117
Evalue 8.13701e-05
Total Hit Count 5
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig39
GCCCTTCGACGAGGACTGCAGCGACGACGAGGCGGACGGCGGCCGCCGGAATCCGCATGGGGACGCCGGCGAGGGGACCAGCGGCGGCAAGGGCGGCTGC
TCTTCCTCCTCCCACGGCCATGAACACGGCCACAGACACCACCACTGAGCTCCGGTTCGATAAGGCAACTTCTGATGGGCCTCCTTGTCTACGCTTGATG
TCGTCAAGGAAACATTGCTTCTGTGTGCCAAAAACATTAGGTGAAAAGCTAGTTTTACCATATCCTCAAACTTGCAAGAGGATGCACCTTCTATATCAAA
CTGTACTGTTGCTTACATGCAATCCAATGTTATAAGATGTATAAATGCAACACCTGTTATCACTGTCGTGATTCGGTGAGTTTAAAAATTGTCAGGATGT
TCTTGGATATTCTTTTTGGCACCTCATTATCCTTGTGGCCGGAAAAGCACCGTGTTGTCTGTTTAAAAAAAAAA
page-top