Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig36
Contig Information
Length 269 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n3g12    rwhv3n3g12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_37384 [Oryza sativa Indica Group] (no hit)
Score 1072
Evalue 7.19065e-115
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig36
CCTCGTGCCGAATCGCACGAGGCGGCTCCATGCAACATAAAGATCCCCCCTGCAGGCTGGAGCTTTTGTGAACTGATGAGGAAGAACATTGTGTGTTACT
TTGGCCCAAATAGAAATTGCTCCATTTTTCAGACAGGCACTACAATGTAACAGCACGGTTTTCATTACACTATAGCGAACATGTTTACATAACGTTTAAA
GATGCTTGTAGTTTTGGGATTTGTGGAAACGTCTATGAAATCTGTATACATTTCAGTTTAAAAAAAAAA
page-top