Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig34
Contig Information
Length 959 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n12a15    rwhv3n12a15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_025048 [Oryza sativa (japonica cultivar-group)]
Score 625
Evalue 4.54499e-63
Total Hit Count 249
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig34
TGTCACAGTCTTCGATGTTGGAGGTGTGTTGGGAGGAGTCCTTGCCGGTCACATCTCTGATCGCGTAAATGCACGAGCAATCACGGCCGCGAGCTTCATG
TACTGTGCCATACCTGCCCTTTTCTTGTACAGAACATATGGAAGCATGTCGATGATGTCGAACATTTGCCTCATGTTCATCACTGGCATGTTTGTCAATG
GTCCTTATGCCCTGATCACAACCGCAGTGTCAGCTGACCTTGGCACTCACAGCTCATTGAATGGTAATTCTCGGGCACTGGCCACTGTGACAGCAATCAT
CGATGGGACCGGGTCGGTTGGTGCTGCGATCGGGCCATTGCTCACAGGATACATCTCAACAGAGAGCTGGAGTGCCGTGTTCACGATGTTGATGGCAGCA
GCACTTCTTGCTGGGCTCCTCTTGACACATCTTGTCTGTGCTGAGCTAAGAGGAAAGCTGTCTTCCAATGTGAGCAAGGTTGTCGCCAATGCACAAACTA
CCTGCTCAGATCAAGTATAGGATTGTAAGTATGGTCTGCTCGCGCTCACGATGTGGTATTATGCATTGGAAACAATTTTTGTAGTTCCATCACCTTCTTG
GTCGACATCAGTATGAGTCTGAAATAAGCTGAAGGATGGGGTTTCCGAGTGACTTGCTCCGTACAAACTCCAGGAATGACTAGCAGAGGGTAGAAAAGTT
ATGTCCAGATTTTTTATTTAGACAAGATGGAGGTGAAAGCACCAAAAGTTTCTGAGCCCACATATAATTTCTTTTCTCTAGTGCCTTGTAAATATGAATT
GGGCAATAAGTTTGGGCCTGTGTTTGCTTGTATCACTGCATATTTAAGCTTGTACGCATGTGATTGCTGTTTAGGGTAGATATAAGGAAATCTCCCTCTA
CAAGAGAGATCCGATTCTATCTGCTGGCCATCTTGATCCCCTTTTGTACTTGTAAATAC
page-top