Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig33
Contig Information
Length 493 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n3i19    rwhv3n3i19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit arylsulfatase precursor [Bacteroides fragilis YCH46] >gi|60682556|ref|YP_212700.1| putative exported sulfatase [Bacteroides fragilis NCTC 9343] >gi|52217399|dbj|BAD49992.1| arylsulfatase precursor [Bacteroides fragilis YCH46] >gi|60493990|emb|CAH08782.1| putative exported sulfatase [Bacteroides fragilis NCTC 9343]
Score 75
Evalue 6.05585
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig33
AGATGGACGTGGAGATGGTCAAAGCCGCCGTCAAGGAGGAGACCGTCAAGGAGCGCGTCGAGACGGCGCGCGCGCGGTGCCGCCAGGCCATCCTCGTCGC
GCTCTCGCTGTGACCGTGGCTGCACGCACGCTTAGGGACGGGTGTAATCACGTCTAAGTATACTGCTAGCACTTAATGCTGTGCATAGAAATTTTGTTAT
CGAGTGGTGCAATGAGGTCAGTCTACTCAAGCTGCAGCAAATCTGAATGTTCTGCACCGGTCAACTGTACGCCGGTTGTGTGTCATTCTGCAAGAAGGCA
GACAACATGGCCGCAGACTCGAGCAGTCTATGGTAGTGTCATGGCCTGGTCGGGTCCACGATCCCTCTGCAGATGACGAGATGTGGCAGGTGGCACCATC
TTTTCTGAGGGTTGTAAACGAATCAGGTACAATTCAGGCTAACTGTACTTTGCATTTGATGCTAAATAAACTAGCTCTGTTTTAAAAAAAAAA
page-top