Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig32
Contig Information
Length 859 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n3i22    rwhv3n3i22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Erwinia chrysanthemi IndA protein homolog-like [Oryza sativa Japonica Group] >gi|218201412|gb|EEC83839.1| hypothetical protein OsI_29792 [Oryza sativa Indica Group]
Score 702
Evalue 3.69256e-79
Total Hit Count 297
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig32
ATACGGTGAAAAAACCATGGACATCTCATCTGACTTAACTGAACTTGGAAAGACGCCTGTGGCTGTTATTTCAGCCCGGTGTGAAGTCCATTTTGGATAT
CGCACGGACACTCGAGTACTTGGAAACTCAAGGGGTAACTGTTGCTGCTTACAGAACCAACGAATTTCCAGCTTTCTTCACAGAAACCAGTGGATGTAAG
GTGCCATGCCGTGTTGATTCTCCAGAAGAGTGCGCGAAGATAATATATGCAAACCAGAATATGCATCTAGGATCTGGAATTCTTATTGCAGTGCCGGTTC
CCAAGCAACATGCAGCTTCAGGAAAGGTTATAGAGTCTGCAATACAGCAATCCCTCAAGGAAGCAGATGATAAAAGAATAATAGGAAACGCGATCACCCC
CTTCATCCTCGACAGAGTGAAAGTACTAACTGGAGGATCTTCATTGGAAGCCAATATTGCACTTGTGAAGAACAATGCTCTCACTGGTGCTAAAATTGCT
GTAGCCCTTTCTGATCTTCGCAAGAGAGTAACAAACAGGCCTGTGAGGTCTGCCCTGTAAAGCTCCTGCTGAAGGAGCATGTGAAGTTGATGATGCCAAC
AGCTGACCGGAACTGGAGTGTTGCCAAAGATACCAATTCCTTGCACATCGTGAATCATCATCTGGCTTGCGCATTCCGTTCTTGCTATTTTGTATCTTGT
TGGAAGGCTGTGTTAGCAGTAACATCTGAATAAATAAGTTTTAGCGGACGTCTCGTTCTGGCCTATGAAATTATTACCGCCTTTGTTGTAGGCAGATCCT
ATTCGGCGCGTAGGTCGCCCGCTAGCGACATAGCGTGCAAACTTCCATTTAGGGTTATC
page-top