Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig31
Contig Information
Length 1327 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n3k05    rwhv3n3k05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Oryza sativa Japonica Group]
Score 659
Evalue 1.38073e-166
Total Hit Count 124
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig31
TCTTCCGTCTGGACCAGTTATGAGCAGTCTCTGGAGAATGCTTAAAATGCTCCAATGATATGAAGGCTGACTCAGTTACTTGTGAGACATCGGAAGAAGT
TACCAACCTACAGTCACAATTGGCATCATTGGAGAGAAAAAATGCTGACTTCAGGAAGCAGATCAATGAACTCTTGGTGAAGCTTCAAATGGCTGGGCAA
GGAAAAAACCAGGCTTTGTACAGTGCTGGTCCTTTTGGTACCGTGAAGGCTCTTAGAACAAATCCAACAGTCATGCCTGATGAATCCACCAATCCCAGAC
TGGCCAAGATATTGCAACAGGTTGCTGTAAAGAAAGAAATCATCGTTGCAGTGGCAAACTCTAACGTGAAACAGACGCTTGAGATGTGGTTTACTAATAT
CAAAAGAGTTGGAATCACAAATTACTTGGTTGTTGCATTAGATGACAGCATAGAGAACTTCTGCAAGTCCAAAGATGTCCCAGTTTATCGGCGGGATCCT
GATGAAGGCATTGACAGCATAGGGAAGACAGGTGGAAACCCATGCTGTTTCTGCCCTGAAGTTCCGCATTTTGAGGGAATTCTTGCAGCTTGGGTACAGT
GTTCTCCTCTCCGATATTGATATCATGTTCTTCCAAAATCCCTTTGATCATCTTTACAGAGATTCTGATATAGAGTCCATGAGTGATGGCCATGACAATA
TGACAGCCTATGGTTTCAATGATGTGTTTGATGAGCCTTCAATGGGCTGGGCCAAGATACGCACACACGATGCGCATATGGGTTTTTAATTCTGGATTTT
TCTTCATAAGGCCAACAATCCCTTCAATTGAGCTCTTGGATAGGGTAGCTGGTCGCCTTTCTCGTGAACCCAAATCATGGGACCAGGCTGTTTTTAACGA
GGAACTCTTTTTCCCCTCGCATCCTGGTTATGTAGGTCTACATGCATCCAAAAGAACCATGGATATATATCTCTTTATGAACAGCAAAGTTCTCTTCAAG
ACTGTGAGGAAAAGTGCTCAACTTCGGAAGTTGAAGCCAGTGATTGTGCATTTGAACTACCATCCTGATAAGGAGGCGCGCATGAAAGCAGTGATTGAAT
TTTATGTTCATGGAAAGCAGAATGCACTTGATCATTTCCCTGATGGATCAGAATGATAAACCAAAGCTTATTAGGAAACAGCAAATGACCCTTCTTGTTT
TTTTGCTGTTATCCATTGTTCTTGAAACTCTGGATGGAAGCACGTATCCGTGACTACTGTAAAACAATACATGGTAATTTTGGAACATTGTGCTTGAGAT
GTCAGACTTGCAGTGAGCATCTAACCC
page-top