Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig30
Contig Information
Length 754 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n3m07    whv3n8g04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0108300 [Oryza sativa (japonica cultivar-group)] >gi|50510015|dbj|BAD30627.1| putative alanine aminotransferase [Oryza sativa Japonica Group] >gi|113610252|dbj|BAF20630.1| Os07g0108300 [Oryza sativa (japonica cultivar-group)] >gi|125556971|gb|EAZ02507.1| hypothetical protein OsI_24612 [Oryza sativa Indica Group] >gi|125598862|gb|EAZ38438.1| hypothetical protein OsJ_021921 [Oryza sativa (japonica cultivar-group)] >gi|215695377|dbj|BAG90568.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1137
Evalue 1.27248e-122
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig30
CCTCTGCGGCGGCGCACGAGGGATCTGCCTCCGTCCGGAGAAGACGAGAAGATGATGGGGAGGAAGGCCCTGGACTACGAGGAGCTCAACGAGAACGTCA
AGAAGGTGCAGTACGCCGTGCGCGGGGAGCTCTACCTCCGCGCCTCCGAGCTCCAGAAGGAGGGCAAGCGGATCATCTTCACCAACGTCGGCAACCCGCA
CGCCCTCGGCCAGAAGCCACTCACCTTCCCCCGCCAGGTGGTGGCGCTCTGCCAGGCTCCCTTCCTCCTCGATGATCCCAACGTCGGCCTCATCTTCCCC
GCCGATGCCATCGCGAGGGCCAAGCACTACCTCTCCCTCGCGCCCGGCGGTTTAGGTGCTTACAGTGACTCCCGAGGTATCCCTGGGGTTAGGCAGGAAG
TTGCCGAGTTCATTCAGAGGCGTGATGGGTATCCAAGTGATCCAGAGCTTATCTACCTCACTGATGGTGCCAGCAAAGGTGTGATGCAAATGCTCAACGC
CATTATCAGAAACGAGAGGGACGGGATTTTGGTCCCTGTTCCACAATACCCGCTTTATTCTGCTGCCATTTCCCTCTTTGGTGGTTCTCTTGTCCCGTAT
TATTTGGAAGAAGAGGCTAACTGGGGACTTGATCTTGTCAGTACCCGGCAATCAGTTGCAGAAGCACGGTCAAAGGGAATCACTGTTCGAGCAATGGTGA
TAATAAACCCAGGAAACCCTACTGGTCAATGCCTAAGTGAAGCAAATATTAGGG
page-top