Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig29
Contig Information
Length 647 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n12g18    rwhv3n12g18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit mitochondrial import inner membrane translocase subunit Tim10 [Zea mays]
Score 340
Evalue 2.43854e-30
Total Hit Count 315
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig29
CCTCGTGCCGGCAAAACCCTAGAGATTGAGGCGCGGCTGCTCTAGCGTTCCTCTTCGCCTCCGCGGCATCTCGACCACCGCCGCCGCCGCCGAGCTCGCG
AGATCTCCGGCCTACTCCGGTCATCCTTCCCCGCGAAGGCGTCGCGACAATGGCTGCCGCCAAGGACGTGCGGAGCGAGCTGGAGAAGGAGATGATGTTC
GGGATGGCGGAGAAGGAGATGGAGTACCGGGTCGAGCTTTTCAACCGGCTTACACATGTTTGTTTTGAGAAGTGCATTGAGAAAAGGCATAAAGAAGGTG
AACTCAATATGGGAGAGAACAGTTGCATTGATCGGTGTGTTTCAAAGTACTGGCAGGTGACTAACATTGTCGGCGGAATGCTCGGGACTCAGCAGACCCC
GATGTGAGCGCACTGAGAAGCAGTAGTCGCATTTTCTGTAGCAGGACACCGTCCCCATGTTTCTCCTCTGTTTTTGTTTTGGAATGTTCGCCGTTTCGCT
AAGTAAAGCATGAGTGACCGACTAATTCATATATACTGTTCAAAAGGGAACCCTCAGCGTGTCGCGCTTTCCAGTGGTGTACCATGCCACTGAATCATGG
GCAGGGGCGCATGCCTGTAATAATTTGGTACAGCTCGAAAAAAAAAA
page-top