Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig28
Contig Information
Length 830 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n3k14    whv3n3m14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0615100 [Oryza sativa (japonica cultivar-group)] >gi|38344254|emb|CAD41792.2| OSJNBa0008M17.7 [Oryza sativa (japonica cultivar-group)] >gi|113565438|dbj|BAF15781.1| Os04g0615100 [Oryza sativa (japonica cultivar-group)] >gi|215697586|dbj|BAG91580.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218195572|gb|EEC77999.1| hypothetical protein OsI_17392 [Oryza sativa Indica Group]
Score 1284
Evalue 1.37014e-139
Total Hit Count 484
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig28
CCGGAGGATAGGTATGGATTGTACGCCATCGACACATTGGACCCAGACCTGATTATTGGTGATGACAGTGTTTACTACTATCATGACATGATAGTGCAAA
TGATTAAATGGGGATATCAAGAAGGCAAAACTCTGTTCGGATTTGGTTATGATTTCCGCCAAAGTAACAGGCTTTCGGAAACACTTGACAAATTTTCTAA
CAAGCTAGAGTCAGTATACACAGCTTCAGGAGGGAAAAAGATCAATCTAATAACACATTCAATGGGGGGATTGCTTGTTAAATGCTTCATGTCTCTTCAT
GGTGATGTCTTTGAAAAATATGTGAAGAGTTGGGTTGCAATTGCTGCACCATTTCAAGGTGCGCCTGGGTACATAAATAGTGGTCTGCTGAATGGAATGT
CTTTTGTGGAAGGATGGCAATCAAAATTCTTCATTTCCAAATGGACTATGCAGCAATTGTTGATTGAATGTCCATCAATATACGAGTTGTTGGCTAGCTC
AACCTACCACTGGGAAGATACACCATTGCTACAGATCTGGAAAGAGAGCTTAGATGACAATGGCAAGAAAAGTGCCATACTGGAGTCCTATGAACCAGAT
GAAGCAATAAAGATGATTCAGAAAGCTCTTTCCAAGCATGAGATTATCTCTGATGGAAATCACATTCCTCTGCCCCTTAATGAGGATATATTAATATGGG
CAAAGGAAACTCAAGATATCTTATCCCAGGCAAAGCTTCCAAAATCAGTGAAGTTCTACAATATTTACGGGATTGATTATGACACTGCTCATACTGTTTG
CTACGGGAGCAAACGGCACCCCTATTTCAA
page-top