Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig25
Contig Information
Length 1035 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n12g04    rwhv3n12g04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0144100 [Oryza sativa (japonica cultivar-group)] >gi|13486898|dbj|BAB40127.1| unknown protein [Oryza sativa Japonica Group] >gi|113531533|dbj|BAF03916.1| Os01g0144100 [Oryza sativa (japonica cultivar-group)] >gi|215678959|dbj|BAG96389.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765141|dbj|BAG86838.1| unnamed protein product [Oryza sativa Japonica Group]
Score 525
Evalue 2.0154e-51
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig25
GGATGCAGGGAGGCGGGCCGTACGGGCAGCAGGTGACGCGGGGGCAGGACCTCACCGGGAAGGACTTCAGCGGCCAGACGCTCATCAAGCAGGACTTCAA
GACCGTACCTAACTACTCTCACCTCCCCTTTCCATCGATTCCTACAAATTGTTTCACTCGTGATGATGTGATCATGCCTCAGATTTCTTCTTGCGGTTAT
ATCAATAGCAAGTTCTGACTGAACTTTCTTAGCATGTAGAGATAGAACAGAACGTCTGAATGTTCAGAGTATTTCTGAACTCTGACGATTTATCCGAATT
TGCGTTTCTTTCTGCAGTCTATCCTGCGGCAGACCAACTTCAAAGGCGCGAACCTGCTCGGCGCCAGCTTCTTTGATGCGGACCTGACAGGCGCTGATCT
CTCCAACGCCGACCTTAGAAACGCCGATTTCTCGCTGGCAAATGTAACAAAGGTAAATTTAACAAATGCCAACTTGGAAGGGGCACTTGTGACAGGGAAC
ACTTCTTTCAAAGGTTCCAACATATACGGGGCAGATTTTACTGATGTTCCACTACGAGACGACCAACGGGACTACCTCTGCAAAATTGCTGATGGGGTAA
ATACAACTACCGGGAACGCTACGAAGGAGACTCTCTTCTGCAAATAATGAACATAAATGAAGGAGAATGGGGATACTAGAGAATTCAGAGGTTGATTTAG
TTCTCGAATAGTACTGCCATGTTTTTCTCTCTTTTTTTCTTATATCTTCCNGGATGGAGAGAGTTCCATGAACNCNCAAAGAATATATGTATCGGGTGAA
TGGTTGCTGGGAAATCAAGTGCTTAGTCGGATGGTGTTAGCCTGGCAGGCATATTTAGTCCAGGGGTAGTTTTGCCGAAGTGTGCATAACAAAGTTGAAG
CTGTTAGGTGTGGCAAAAAAAAAATCAGTCAAATATATTCCTTTGATAATAATATTGATACATGGAAATTCCATTCATCTATTTTTTCCAGAGTGCACTA
GTTGGGTCGATGCTGTAACACATCAGAGGCAATAC
page-top