Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig24
Contig Information
Length 538 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n4f21    rwhv3n4f21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os09g0375900 [Oryza sativa (japonica cultivar-group)] >gi|49387690|dbj|BAD26036.1| hypoxia-responsive protein / zinc finger (C3HC4-type RING finger) protein-like [Oryza sativa Japonica Group] >gi|113631273|dbj|BAF24954.1| Os09g0375900 [Oryza sativa (japonica cultivar-group)] >gi|125563505|gb|EAZ08885.1| hypothetical protein OsI_31148 [Oryza sativa Indica Group] >gi|125605501|gb|EAZ44537.1| hypothetical protein OsJ_028020 [Oryza sativa (japonica cultivar-group)] >gi|215765284|dbj|BAG86981.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215768257|dbj|BAH00486.1| unnamed protein product [Oryza sativa Japonica Group]
Score 401
Evalue 1.26268e-37
Total Hit Count 154
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig24
ATTCCCCTTCCACCTTTTCCTCCCAGGCGACGCGAATGGAGAAGGGCTCCGGCGCCGCCGCAGGAAGCAGCGCGCGGCCGCCGCCGATGCCGCAGTTTGA
CGAGTTCCCGTTCGAGGGGAAGAAGCCCGTCAAGAACCCCTTCGTCCCCATCGGTGCATTGGTCACTGCGGGCGTCCTGACAGCTGGCCTGGTCAGCTTC
CGGTACGGGAATTCTCGGCTGGGTCAGAAGCTGATGAGGGCCCGTGTGGTTGCTCAAGGCGTTACGGTTGCTCTGATGGTCGGCAGCGCATACTACTATG
GTGACCAAATCAAGTTGTTCAAGAAAGGGTCTAGCCCATGAACTTGACTGGATAGTGGTTGTGGTGTACGGAATGGCATATCTTATGTACTGAAGTTTCA
CCTGGGGCTCTGCTGTTCGATTGCCTCCTGGTCCTGGGGATTAACTATTGTCATTCACGCTTGGCTAACTAGAAGTAATTTTGGCGCAATCTCCAGGCTT
AAGAATAAATCCTTTTATTCGTTGACTCAAAAAAAAAA
page-top