Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig23
Contig Information
Length 668 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n3m12    rwhv3n3m12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195628342|gb|ACG36001.1| DNA-directed RNA polymerase II 19 kDa polypeptide [Zea mays]
Score 700
Evalue 4.67747e-72
Total Hit Count 251
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig23
GCGGGCGGCACGGCTTCGTGGTGGCGATCACGGGGGTGGAGGACATCGGCAAGGGGCTCATCCGGGAGGGCACGGGCTTCGTCACGTTCCCCGTCAAGTA
CCAGTGCGTCGTCTTCCGCCCCTTCAAGGGCGAGATCCTCGAGGCCGTCGTCACCATGGTCAACAAGATGGGGTTCTTCGCTGAGGCTGGGCCTGTGCAG
ATCTTTGTGTCAAACCATTTGATTCCTGACGATATGGAGTTCCAATCTGGTGATGTGCCAAACTACACTACTTCGGATGGATCGGTGAAAATTCAAAAGG
AAAGTGAGGTTCGTCTGAAGATTATAGGCACTCGTGTTGACGCAACAGAAATTTTTTGCATCGGCACGATAAAAGACGACTTTCTGGGCGTTATCAGTGA
TCCTGGTGGAGCGCTGTAAATGATCCAAACAAGACTCAGCATGCTCTCCAACTTCCGCATCATCATATATCTGGGAAGAGTCCCCAAGGAAGGTTGCGAC
TGATCTGTAATTTGTGTCCTGATGTAAAATGTGATGTCATGCCTATCTAATGGAAGTCAGGGTCCTGCTAGTGTTAAAAAAAGTAATTGGCACCTGTAAT
ATCATAACTAGGATCTTTTTAACTGTGGTGGTTGATAAGTTTAGTTGTCTGAACCTCCAAAAAAAAAA
page-top