Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig21
Contig Information
Length 365 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n3m13    rwhv3n3m13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein TRIADDRAFT_56103 [Trichoplax adhaerens] >gi|190586155|gb|EDV26223.1| hypothetical protein TRIADDRAFT_56103 [Trichoplax adhaerens]
Score 74
Evalue 7.7863
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig21
CCCGCGCCGACTAGAAACAAAAGCGCTTGCAAGCAAGGGGCATAGGGTCCATCATTGTAATTCTGTTTGAAAGGGGTTTATTTCTTCCTAGAGACCTGTT
TGGCATTACGTTGTGGTTCTACTTGTGTGTTCATGCTCCTCGACAGATCAATCAAGGAACATAATGTGGTTTGGGATCATGGGGATTTCCACGCCCGCCA
TCTGTAATTTTATTCTATGTTCGACAACGCAAAGCTACCTGTATCTACTCGTCGTACCTAGCACCTGTTGTATTTATTGTTTGGAGTAATAATCGGCGCT
GAGCCTCTTGGGATGCGAATGCGATGAATGAATAAGCAAAGCTAGACCTAGTTCCAAAAAAAAAA
page-top