Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig18
Contig Information
Length 656 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n4g16    rwhv3n4g16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit large S protein [Hepatitis B virus]
Score 79
Evalue 4.56848
Total Hit Count 12
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig18
ATTGATTTTACCACGTAGACGTTGGTCTGAACCTTCTGGCCGGCTACATAAGCAAGCACTCAGGCAGCTGGAAGGATTCCGGGCGCACAGCTTGCCGTGA
ACCTTAAATTGCTGCTCCAACAGGTAGCAAACCAATCATTTGATATTTGAGGGACAACAGTCAGCAGGCGCTTTGAGGAAGCATTGGTGCTGGCAAACAA
AAGAATGCTTTAGGTATACCTATTTACACTTTTCAATTGGTTTGATGCCATCTGTATGTGATTCACTGACCAAGAATGGAAATATTCCTTGCTATTAGAA
ATTTCTATGGTGGTGCTTCTTTAGGTTCCACCTGATGAATGTTCCAGTGCCAATAATCGGTTATATATACTTTGTAATGGTGATTCCTAATTTGGTCTAA
CTTTCTAACTATTAGCTACAGTTTACTTCAGTGGTAATGCAGGTACGCAAAGGAAGAATTACTGGCTATGGATGATTACTATGAGCGTATGAAATTATTA
ATTGTGTAGGTTTCTTAAGCTAGATGGGTTGTTCTAGCTTGTGATGGTTAAATTTTTTACACAATAGCAGTACTAGATTAGTTGTTCTAGCTTCTTTAGG
CTGTAACCATTTGAAGGTAATTTGAAGATCGATCCCACAGCTGAGTAAAAAAAAAA
page-top