Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig17
Contig Information
Length 1139 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n4f24    rwhv3n4f24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0442300 [Oryza sativa (japonica cultivar-group)] >gi|87116392|dbj|BAE79355.1| typeA response regulator 1 [Oryza sativa Japonica Group] >gi|113564453|dbj|BAF14796.1| Os04g0442300 [Oryza sativa (japonica cultivar-group)] >gi|118790814|tpd|FAA00263.1| TPA: A-type response regulator [Oryza sativa Japonica Group] >gi|215704280|dbj|BAG93120.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215740726|dbj|BAG97382.1| unnamed protein product [Oryza sativa Japonica Group]
Score 804
Evalue 1.03782e-83
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig17
CTTCATCACTGGCCTGCAGGTGCGCCGGGTCATCAAATCAAATGCTCGTACTCCCTCCCACCTCCCGCCCGGCTGCTTAAAAGCCCATTCTCGGAGGGCC
GAGGACCTGCTGCTGCTGCTGGAGTTTGTCTGGTAGAGAGGAGAGGAGAGGAGAGGAGAGGAGAGGGAGATGGAAGGAGGAGGCGCGGAGGGGGTGACGA
GGGTGCTGCTGGTGGACGACTCCCCGGTCGACAGGAAGGTGGTGGAGCTGGTGCTCGGCAGCAACACCTTCGCCGGCTCCTTCCACGTCATCGCCGTGGA
CAGCGCCAAGAAGGCCATGGAGTTCCTGGGGCTCAAGGACGGCAAGGAGCAGGCCGTCGACATGGTGCTCACTGACTACTGCATGCCCGAGATGACCGGC
TACGACCTCCTCAAGGCCATCAAGGCCATGAGTCCTCTCAAGCCTATCCCGGTGGTCGTCATGTCGTCGGAGAACGAGCCCCAGAGGATCAGCAGATGCC
TCAAGGCTGGTGCTGAAGATTACATCGTCAAGCCTCTTCAGAGCAAGGATGTGCCGCGCCTGAGGAGCTGCTCGAACGCGAAACCCAAGGACCCTCCATG
CAGCACTGTGAGCAAGAGCGCGGACCATATAGCTGCTGTCGATGGCACGTCGTCGTCGCTGCGACGGCGAGCACACCTCACCGATATTGCCATGGTCCTC
CACTCGTCGAGCGCCGGGCTCTCGCACTACTTCCCGTTCCTCTTCAAGTTCATCCTGCTGGTCTACGCCATCCTGTGCGTCGGCGAGCTCCTGCACAGAT
GGTCCAACGGCTGCTTCCTCTCCTACCTGAGGTGATGGTGCCGCGGTCCAGTGACATGCTGCAGCTCTGCAAGGAGGAGTAGCTCTTGTGTCGTAGCTTA
TGAGTGAGCAGTGAACCTCCATGTTTCAACAACCATGGATGGAGCTTTAGGTAGTAGATTCGTTTGCTTTGAGATTCTAACCGGGCGGGCGTCGGTTCTT
GGCCTTGTTGGGCTGGTGAGTCGAGGAAGAACCCCTTGTATCCATCCTTGTACAAAACGCACAATGAGGCAGGCAGTATCTGATGTCCCTTTTGGCTTGG
ATCTTGGCTGATCTACTGATGTGACATCCAGGGAACTTT
page-top