Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig15
Contig Information
Length 1152 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n4f03    rwhv3n4f03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Formin-like protein 7; AltName: Full=OsFH7
Score 1123
Evalue 1.07914e-120
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig15
GCAGCAAAGAGAATCTAGGAAAATGTGAGCAGTTCTTCTTGGAAATGATGAAAGTGCCAAGGGTGGAGTCAAAACTGAGAATCTTATCCTTTAAGATAAA
GTTTCTTACACAGGTTGCAGACGTGAAAAATAACCTGAATACCATTAATGATGTTGCTGAAGAGGTTAGGAACTCTGACAAGCTTAAGCGAGTGATGCAA
ACAATTCTTTCCTTGGGGAATGCATTAAACCAAGGAACTGCAAGGGGTTCAGCCGTTGGATTTAGATTAGATAGTCTTCTTAAGCTCATTGATATACGGG
CACGAAACAATAAGATGACTCTCATGCATTATTTGTGCAAGGTTCTTGCAGGCAAGCTTCCTGAAGTTCTTGATTTTGTTAAGGATCTTGCGCATTTAGA
ACCCGCCACAAAGATCCAATTGAAAGACTTGGCGGAGGAAATGCAAGCGATAACTAAGGGACTGGAAAAGGTCGAGCAGGAACTGGCAACATCTGAAAAA
GATGGTCCAGTGTCTGAGACGTTTTACAAGAAACTGAAGGAATTTCTGGCTGATGCCCAAGCTGAAGGGAGGTCATTAGCTTCGCTTTACAGTACAGCGG
GGAAAAGCGCGGACTCTCTAGCACATTATTTTGGTGAAGATCCTGTGCGGTGCCCGTTTGAGCAAGTTGTCTCTACTCTGCTAAGCTTCGTGAAAACCTT
CGAGCGGGCCCATGCCGAGAACCTCAGGCAGGCGGAGGCGGAGAAGAAGAAAGCCCAGATGGAAGCTGAACGAGAGAAGGCGAAGGCAGCCGCCGCTCAC
AAGAAGGCGGGGTCGCCGGAGCCAGGAGTTTCCGACCGATGACTGACCCGTCGTCGAAGCTAGACACGACATATTTCCACTAATTTCTTACCGTGTGAAA
GTGGAGGCCAGGAAGACAAAGCTCCGTGTAAAAAGAAAAGTCACAGGCAGTAGTGCATACCAATGTGGCAAATGTGATTGATAGGTAGACTTGATATAGC
GACGCATTTAGCACATAGACGTATAGCGCACTGCTGCTCACTGTCCATAGATAAAGTTTTGTACCGCTGCTCACTGTCCATAGGGAAAGAAGTTCGTACA
TACATATGTTGTATATTTTGGGGTTTTTCCCCCCCTGGCGACAAACAAATTT
page-top