Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig13
Contig Information
Length 414 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n12e10    rwhv3n12e10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative 50S ribosomal protein L3 [Oryza sativa Japonica Group]
Score 453
Evalue 8.77256e-44
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig13
AAGAGGCACAACTTCAAGCGTGGTCTGATGACTCACGGTTCCAAGAGCCACAGAGCCCTAGGTTCGATCGGTGCGGGGACAACCCCAGGGCGGGTGTACA
AGGGGAAGAAGATGCCCGGGAGGATGGGCGGAACCAAGACCAAGATCAGGAAGCTCAAGATTGTCAGGATCGACAATGATCTCAAAGTTGTGATGATCAA
GGGGGCCATTCCTGGGAAGCAGGGAAACCTTCTCTGCATCACGCCCGCGAAGATTGTCGGCAAGAACATCCCCAAGAGCTAGATCTGTGCTGCGTTTCAC
CTTGTAAGAGTTCATTCGTTTCCTTTTCCATGACTGGCACTGTTGTATTCCCAGGTCCAGGTTTTGTATACATGTTCAGTTTTCTAAAGCTAATCTTTGG
ATACAAAAAAAAAA
page-top