Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig12
Contig Information
Length 834 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n12e04    rwhv3n12e04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os09g0542800 [Oryza sativa (japonica cultivar-group)] >gi|32526676|dbj|BAC79199.1| chloroplast RNA processing 1 -like protein [Oryza sativa Japonica Group] >gi|113632057|dbj|BAF25738.1| Os09g0542800 [Oryza sativa (japonica cultivar-group)] >gi|125606498|gb|EAZ45534.1| hypothetical protein OsJ_029017 [Oryza sativa (japonica cultivar-group)] >gi|215768653|dbj|BAH00882.1| unnamed protein product [Oryza sativa Japonica Group]
Score 511
Evalue 8.78755e-65
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig12
GTATTCCTGACTGCCACACGTTCAATCCCATGCTGAAGTTGGTCCTGGGGACCCGGCAATGTAGAAGCTGCACGGAAGCTATACGAACGGATGCAGGAGC
TGCAGTGTAAGCCGAATGTGGTGACTTATAATTTTGCTTATGAAGTTGTTCAATAAGGAGAAGTCGATGGACATGGTGCTGAGGATAAAGAAGGACATGG
ATGCACAAGGTGTGGAGCCAAACGTGAACACCTACGGAGCTCTAATCGAGTCATTCTGTGGGAGGGGAAACTGGAGGCGCGCTCATGCGACGCTGAGGGA
AATGGTCGAGGAGAAATCCTTGAAACCCACGAAGCCGGTGTATGATATGGTGCTGATGCTGCTGAGGAAGGCCGGACAGCTCAGGAAGCACGAAGAGCTT
GTGGAATCAATGGCTGACCGGGGCTTCATCAAGCGCCCATCAGAGGATGCCTTGTGGAAGGCAGTAGCTGCTTCGTAAACATTTCTTCCCATACAATCCA
AAAGGACCAAGAAGTTTCAGCTATCAGCACGGTAATGGAACAACATATTTTCAGCTATCCAGTGCAGAAACAAAGAGAATGGGGTTCTGCTGCCACCTAA
TGCTAGCAGCAGCTAAGGAGCTAGAAGATTTGAGTAAACATAAATGACAGCATAAATTTGTAGAACAGCACTTACTGCTGTGAATAGAGGGCCAGGCACA
TCAGGCAAACAACATTGATCAGGCACATCAACTTCACCAGCAGCTACAGGCACCATGTTTTCTGCTTGCTTCCTGAAGTTTATTTGCTAGACTGTTATTG
ATGTGCAATCTTATAAGAGTGGTATTTTTTTTTT
page-top