Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig8
Contig Information
Length 233 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n4b16    rwhv3n4b16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit jacalin-like protein LEM2 [Hordeum vulgare subsp. vulgare] (no hit)
Score 229
Evalue 2.31785e-17
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig8
CCTCGTGCCGCGGGCCTTGAGCCTGATCCGGACGCCGAGGAATGAGGAGCCACCGTCCGGCGGCTGCCTCGTCTCATCTCTCGCCTTACACTCCGTTTTC
AGCTTTGTACTAAAGCAGGACAATGATGTATGTACATACGTATACATTTGACATCTGGGCTCGGTTAATTCCACAAGAGAACCATCAATCGTGTAACACC
TTTCAAACATACACATCTCCAACAAAAAAAAAA
page-top