Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig7
Contig Information
Length 727 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n1l23    rwhv3n1l23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit jacalin-like protein LEM2 [Hordeum vulgare subsp. vulgare]
Score 229
Evalue 2.31785e-17
Total Hit Count 231
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig7
CCTCGTGCCGCGCCGGCGATGAAGATGGGCCCGTATGGCGGCCCAGGAGGGAATCACTGGGACATTAATGCTCTCAATCCGCCCAAAAAGATTGTGAGCA
TCCAGATTTGGAGCACTGATTCCTCATGCGAAGGGGCCAGCGGGGTCATCAACGGCATCTCGTTCAGCTATCTTGACATGGCAGGGCAACTAATCCCCTC
GGGTCCATGGGGCTCCCAGACCGGTAAACCCCACGTGATTAACATTGGTGAAGACGAGCGCCTGATCACTGTCTACGGCACCAGCGATGGCAAATTTGTC
ACCTCGCTTAAATTTGTCACTGACAGGGCTTCCGATCCGTATGGGCCATACGGGGCACCGTCTACCATAAGTACTTTCAGCTTCCAGGGCGGCTCCATCC
TCGCCTTCTTGGGCCGCTCCTCAGACAAACTCAATGCCATCGGCGCCTACAAACTTGGGGTTTGATCCATCTAACCATCATGGCCAGCATACGTGTCTGC
TGACTTCCGTATGGTTGGCTTCGGTGGATACATGTGTTCGACCTATATCTACTGCTTGTATTTGCAGCTAAATAAAATGGGGATCCCTCGCTGATGCATC
CTATGGATGGATGGATCCCTGCCGTCCGTACGTGTGTGCGCGTGCTCGCTCTTTGTTTCCGTATATTGTATCGTCCTANCCTGTGTAACTATAAGATCAA
TAAAAGTCTCGGAAACTAAAAAAAAAA
page-top