Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig6
Contig Information
Length 1230 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n3p04    rwhv3n3p04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os10g0389500 [Oryza sativa (japonica cultivar-group)] >gi|78708513|gb|ABB47488.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|113639110|dbj|BAF26415.1| Os10g0389500 [Oryza sativa (japonica cultivar-group)] >gi|189473500|gb|ACD99649.1| unknown protein [Oryza sativa Indica Group] >gi|215694613|dbj|BAG89804.1| unnamed protein product [Oryza sativa Japonica Group]
Score 413
Evalue 2.54635e-38
Total Hit Count 58
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig6
CTTCTCTTCTTCCCCTCTCTCTCTCTCTGCTGGCCTGGCAGATATTTTTCCTCCGATGAGAGTATACATCTCGGCCTCCGCATCCCTATCCCTCCATCGT
CTCCAGGAGGAAGACGACGGACCACCAAATCCAGCGGATCTTTTCCCCTCTTCTCCATCGATCTGCGTTTCTCCCTGAGAAAATCGACGGCAAAAAATAT
CCTCGCTTTGATCTCCGGCGCCGTCCGGCGAGAGTTCTTGGGCGGAGGAGGAGCTCGGGTTCCATCTGCTCGTCCAACCGCCCGGAGCCATGGGGGACGT
GTCCACGATTCAACGCCCGCCCGGCGCTGCCGCCAAGCAGGGTGATCAGGTTGGAGAGCTGGTGTCGGCCGGATGGACCAACGACACCCACAACATGTAC
ATCAGCTCCATGGAGGCATCCTTCATGCAGCAGCTCCGTGGCCAGCAGCAGCACCACCACCACGCCGCTCCTGACAGGAACATGACCCATGTGGGTCTTG
GCCATGTGCTCAAGCCACACCAAGAGGGAGCTTCAGATAACGCCGGGGCCGAGAGGAACGTCTCCCGCTCGCGTGATGTGGGCGCAAGAGGCCTGCCCGA
GGATCCATGGGCAAGGCGCTTCAAGCCGCGTGATTCTGCTATGAATCGTCGTGGTGATGGGGTTGGTGCTTCTGATGGTGAATCAGGTACTGATACGGTT
CAAGGGGCGGTTCCGAAGCATGGAAGAGAAGTGGTCAGTTGCGTTGGAGGAAATCTTGTTGACAAAACCTCAGAAGAAGTCTCTGGTCAAAACTTTCCTG
AAGATGAGGTTCATTCCGCTGCTCAGCCAAGCAAATCGTGCAAGAAAAGGAGGCCTGCCTCTTCCACTGCTGCAGGTTCTTTCATCTCGATGCTCGGCGA
CAAGCGGTGGTGAAGGCCTGCGTATGTGTTCTAGAAATTCTTGCTGAAGCAGTTGTGATAGGTGACTGGTGCGGCTGCTAATCTTTTTAACTCGTCTGAT
AGCTCTCGATTGGCCTGTCCTTTCGGCGTGAAGGGAAGACAATTCATTGGTGATTTGTGTCTAGTATCCTCTCTGCAGAGCATCAGGCTCAAGTTTGCAG
ATCTGCGAGAGTGGAGGTGTGATGTGATGCCTTGTGGTGGTGTATTTCTTCAGCATCTGCTGTCTGCAAGCGAATCATCGGTTCCTTGCCACGGCAAAAA
TGTATTGGAGAGTTTATACTTTATACTACA
page-top