Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig5
Contig Information
Length 1156 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n12d03    rwhv3n12d03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative phosphoethanolamine cytidylyltransferase [Oryza sativa Japonica Group] >gi|218200697|gb|EEC83124.1| hypothetical protein OsI_28285 [Oryza sativa Indica Group]
Score 1152
Evalue 4.70001e-124
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig5
ACATTGATTACATTATACATGGAGATGATCCTTGTCTTCTACCTGATGGAACGGATGCTTATGCCTTAGCAAAGAAGGCTGGACGATACAAGCAAATCAG
GCGTACTGAAGGTGTCTCAAGCACCGATATAGTCGGGAGAATATTGCAAACATTCAAGCATAAAGAGGGTGTTAACGAGAATGCTGGAGTGAAATCATGC
GATCAGATGAAAACCCAGCTATCCAATTTTCTTCCAACTTCCCGCCGGATAATGCAGTTTTCAAATGGGCAGGCTCCTTCGCCAGGTGCTCGTGTTGTTT
ATATAGATGGTGCATTTGACCTTTTCCATGCTGGTCATGTTGAGATCTTTAGAAGTGCTAGGCAACTTGGTGACTTCCTTCTTGTTGGTGTTCATGATGA
CCAGTCCATCAGGGAAAAAAGAGGCTATCCTCCTATCATGCACCTCCATGAGCGTACCCTGGGTGTGCTCGCCTGTCGCTATGTTGACGAAGTTATAATA
GGCGCACCATTGGAGGTTTCAAGGGATATGATCACTACATTCAACATTTCATTGGTTGTGCATGGGACAGTAGCCGAGGGTGGTTCTGCTAGTGAAGTTG
ATCCGTATGCCCTTCCAAAGAGCATGGGTATTTTCCAAGTAGTCACAAGCCCCAAAACAATAACATCTGTTTCGGTCGCAACAAGAATAATTGATAACCA
CGAAGCATACAAGAAAAGAAACTTGAAAAAGAAGGCGAGTGAAGACAAGTACTACACGCAAAAGAAATTTGTCTACGGAGACTAATGCTGCAAAGGAACC
TTACATTTTTGCAGCAACCTGAGGAAATATATGGCGCCTCTCTGCATTGAAGAGTTATTCTACAACAGATTGCAACAATTCCTCAGCTGTAGAAAGTAGT
CAGTGATAAGTTGATGGCCATTCGGCAGAGGGAATCAGCTCAAGGAAATAAATTAACAGACTGCCACATTCTTCTACTGTTGCCCTTTTCGGCTGGAATG
TCCACTTAACAGCAAGAATTCACATACATGATTCTTTTTTTACTTTGTTATCCCTGGAGGGGAAATATTCATCGCTGAACACCTTCAGCAGACCATTGTT
GTATTCTTGTATGTTATTACTTGAAGGTTTGTGATTAGAGTTGCATACTTCCTAAT
page-top