Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig4
Contig Information
Length 820 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhv3n6k18   
Homology (BLAST) Top Hit S-adenosylmethionine synthetase 2 [Triticum monococcum]
Score 617
Evalue 2.93436e-62
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig4
AGTACTGCTTAGAAGAATGACAATTTGGGAACAATAGGGCAATAGAATTACACATGGCTCTTTAAACTCTGGAAGAAAGAGCATTATGAGGAGAGCATTA
TGAGGGGAAACTACACAAAACAGAATATGAAAAGTGAAAGTGACGAAGTGACAGAGCAAATTGCACATCACTCAGCAGTTTCAGCAGACTCAAAAAGAAA
AGGAAAAATATATGAAATGATACACCAGTAAGAAAACTTAGCACTGATCACTAGACGGCACGACCAGTGTAGCACGTCGCGGTGATGTCGAATGCTTCTT
CTTACTTCCCAGGAGCAAAAGGATCCCGCCTTTGTCGAACTTGAGAGGCAGCAGACCAAGAATAACCCCAATGTGATGTCTTGTTCTTAGGCAGATGCCT
TGTCGAACTTGAGGGGCTTCACCACCTCCCAGGTGAAGTCGGCATCATCGCGGCCAAAGTGACCGTAAGCAGCGGTCTTGATGAACCTGTTTCCACCTTT
CTTCAAGTCCAGGTTGATGCTGATCATCCCGGGCCTGAAGTCAAAGTTCTCCTTCACGAGCTTGAGGATCTCCCTGTCGGGGATCTTGCCGGTGCCGTAG
GAGTCGACGAACACAGACAAAGGCTCAGGCACACCGATGGCGTATGAGATCTGCACAATGCAGCGGCGTGCGAGGCCGCTGGCGATGATGCTCTTGGCGG
CCTGCCTGGCAATGTANGCGCCACTACGGTCGACCTTGGTTGGGTCCTTGCCNNANAAGGCACCGCCGCCGTGGGCTCCCCNNCCNCCATANGNGTCCNA
TGATGATCTTGCGGCCGNNG
page-top