Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig2
Contig Information
Length 783 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhv3n18f10   
Homology (BLAST) Top Hit hypothetical protein OsJ_001395 [Oryza sativa (japonica cultivar-group)]
Score 870
Evalue 1.25925e-91
Total Hit Count 60
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig2
TCACATGGTACAAACTATTAACTATTAGCTTCCGCATCTGCAAAATTACCCATTGGGAAGAAAGGAAACAGCTACATTTGTAATCCTGATGTGTAAGTTC
AAATTCTCCACACCTAATCAGGATCATATGTTTCAGGCTCTCTTTCTCAATATTGTCTTGCGTGGTTCCTTTCTGCTCGGTGTGTTTCCTGAACCTAGGG
AAGTCATTCCTACAGCGCTTTGGTACAAGTCCTTCAACCTTGGCATACTGATCACGACTGTAACAACAGAAACTCCAACAATAAGAGGAAAAACTGGGGC
TGGGGTCAGTTCCTGTTTGTGATGCCGCTCTTCCGTTTTATATTTAAGAGGACCAACATGAATCTGAGGTTGCTTTTCTAGGTCAACTTCAACCAACTCA
GATTCAAATATATGGGTATGTGATGGAAGGCCAGACCGAAGCTGAACAAAATGCTTTCCTTTGGGTAAATTTCTTACTTCGACGTGGTAGGAAAGAGGAA
CAGGAACTACAGATTCTATTCTAGAAGGGTCAACAGCTGATCTAATTTCAACAGATAAATGTGGCTGCAACATATCAATGTCATTTCCTTCCACGTGACA
GCTCAAAATTGTTGCTTCTGGGCGTTCAAAAACCACAAAACCAATACCAGAGATGTCCTCCTCATCGACATCAACTGATACAGATTCTGGTGAAGCACGC
TCAACTGCTGCCAACCTGANATTATCTTTTGCAACTACTCTTATTGAGTAANATGAGCCANGGATAAGTCCTCTCAAGCGGAA
page-top