Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig641
Contig Information
Length 1234 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs10d01    rwhcs10d01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit adenosine kinase-like protein [Oryza sativa (japonica cultivar-group)]
Score 1670
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig641
TCGCCAACGCAGACCTCAGATCTCGCTCTCGCCTCCTTGCGCAGCCGTCGTCGAGAGGAGCAAGAAAATGGCGGCGAGCAACCTCGAGGGTGTGCTCCTG
GGGATGGGCAACCCCCTTCTCGACATCTCCGCCGTCGTCGACGAGGCCTTCCTCGCTAAGTATGATGTCAAGCCGAACAATGCCATTCTCGCCGAGGACA
AGCACTTGCCCATGTACGATGAGTTGTCCAGCAAGGAAAATGTTGAATACATTGCTGGAGGAGCCACGCAGAACTCTATCAGGGTTGCCCAATGGATGCT
TCAAACTCCTGGTGCAACAAGTTACATGGGTTGCATTGGAAAGGACAAGTATGGTGAGGAGATGAAGAGCGCCGCTAAAGCTGCAGGAGTTACTGCTCAT
TACTATGAGGATGAGGCTGCTCCTACAGGCACATGTGCTGTATGTGTTGTTGGTGGCGAAAGGTCATTGATTGCAAACTTATCTGCTGCGAACTGCTACA
AATCTGAGCATCTAAAGAAGCCAGAGAACTGGGCACTAGTTGAGAAAGCAAAATACATCTACATTGCTGGCTTTTTCCTTACGGTGTCCCCTGAATCTAT
TCAGCTTGTTGCTGAGCATGCTGCTGCCAATAACAAGGTTTTCTTGATGAACCTCTCCGCTCCCTTTATCTGCGAGTTTTTCCGTGATGCCCAAGAGAAG
GTTCTTCCGTATGCGGACTATATCTTTGGAAATGAAACTGAGGCAAGGATCTTCTCTAAAGTCCGAGGGTGGGAGACTGAGAATGTCGAGGAGATCGCTT
TGAAGATCTCACAACTGCCTCTGGCTTCTGGAAAACAAAAGAGGATTGCTGTGATTACTCAGGGTGCTGATCCAGTAGTTGTGGCCGAGGATGGGAAGGT
GAAAACATTCCCTGTCATCCTATTGCCCAAGGAGAAGCTTGTTGACACCAATGGCGCTGGTGATGCGTTTGTTGGAGGCTTCCTCTCTCAGTTGGTGCAA
GGGAAGAGCATCGAGGACTGCGTAAAGGCCGGTTGCTACGCAGCAAACGTTATCATCCAGCAGTCTGGCTGCACTTACCCTGAGAAGCCTGACTTCAACT
AGACCAACCAAATTCGGCGATGGTACGGAAAGCAACACTTAACCACTTAATGGTTCGGCTTGTTCTCCCTGTATTATTTTGAGGCTTTCCATCTGATCCG
GCCTATATTTTAAGGCCGTGGATATCTGTTGTAC
page-top