Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig1723
Contig Information
Length 1063 bp
Tissue Shoot grown under cold condition for 16days
Clones 12 Clones [Download: CSV  ,  FASTA ]
whv16n1l21    whv16n2d23    whv16n4l14    whv16n5e09    whv16n7b14    whv16n13p18    rwhv16n1l21    rwhv16n2d23    rwhv16n4l14    rwhv16n5e09    rwhv16n7b14    rwhv16n13p18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit chloroplast oxygen-evolving enhancer protein 1 [Leymus chinensis]
Score 1417
Evalue 7.7883e-155
Total Hit Count 183
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig1723
GAGGTCGCAAGCAAGTGCGCCGACGCCGCCAAGATGGCCGGCTTCGCCCTCGCCACCTCTGCCCTCCTCGTCTCCGGCGCGAGCGCGGAGGGGGCGCCCA
AGAGGCTGACCTTCGACGAGATCCAGAGCAAGACCTACATGGAGGTGAAGGGTACCGGCACCGCGAACCAGTGCCCGACCATCGACGGCGGCGTCGACTC
CTTCCCCTTCAAGGCCGGCAAGTACGAGATGAAGAAGTTCTGCCTGGAGCCCACCTCCTTCACCGTCAAGGCCGAGGGCATCCAGAAGAACGAGCCGCCG
GCCTTCCAGAAGACCAAGCTCATGACCCGTCTCACCTACACCCTTGACGAGATGGAAGGCCCGCTCGAGGTCGGCGCCGACGGCACCCTCAAGTTCGAGG
AGAAGGACGGCATCGACTATGCGGCCGTCACCGTGCAGCTCCCCGGAGGCGAGCGCGTGCCCTTCCTCTTCACCGTCAAGCAGCTCGTCGCCACCGGCAA
GCCCGAGAGCTTCAGCGGGCCCTTCCTTGTGCCCAGCTACAGGGGTTCGTCTTTCCTCGACCCAAAGGGCCGTGGTGGCTCTACTGGCTACGACAACGCC
GTGGCGCTACCCGCCGGAGGCAGAGGAGACGAGGAGGAGTTGGCCAAGGAGAACGTGAAGAACGCGTCCTCCTCCACAGGCAACATCACGCTCAGCGTGA
CCAAGAGCAAGCCGGAGACCGGCGAGGTGATCGGCGTCTTCGAGAGCGTGCAGCCGTCAGACACCGACCTCGGCGCCAAGGCGCCCAAGGATGTCAAGAT
CCAGGGTGTGTGGTACGCGCAGCTCGAGTCTAACTAGAGCAGAGCAGAAGTGAAGATGCTCATCTTGTGTGCATGCGTACGTGGGTTGATCGTTGGAGAG
GAAACAATCGAGGCAACAATGTGTGTTTGTGTGTGTATCTAGTAATCTAAACCCAGGGTGTCGGTTTATATTTTAGCTTCTGTTATTGTTTCTTCCTCGC
CAACTCATGATATTGATCCCCCATGAATGTTCACAAAATTGTCTGTGGACACTTTCTTCGTTT
page-top