Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig1676
Contig Information
Length 2585 bp
Tissue Shoot grown under cold condition for 16days
Clones 9 Clones [Download: CSV  ,  FASTA ]
whv16n1i02    whv16n8d07    whv16n13l09    whv16n13o15    whv16n20i21    rwhv16n1i02    rwhv16n8d07    rwhv16n13l09    rwhv16n13o15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os10g0579300 [Oryza sativa (japonica cultivar-group)] >gi|12039363|gb|AAG46149.1|AC018727_1 putative ubiquinone oxidoreductase subunit [Oryza sativa] >gi|31433693|gb|AAP55177.1| NADH:ubiquinone oxidoreductase 17.2 kD subunit family protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113640038|dbj|BAF27343.1| Os10g0579300 [Oryza sativa (japonica cultivar-group)] >gi|215737278|dbj|BAG96207.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218185079|gb|EEC67506.1| hypothetical protein OsI_34794 [Oryza sativa Indica Group]
Score 749
Evalue 7.08792e-77
Total Hit Count 319
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig1676
TTCATTGCCACATCCACACACAGATTAAAATTGTTCAGTGGCAGGTATTCAGTATCAGATAGAGTACATTATTCAGGTCCAGTCCACGAAACCAAGCTGA
CTGGCGGTTTTAGATCGGCGACACCAAACCAAATGCGAAACATAGAAAGGATTATCAGGTACCATTCAGATCAGATCAGGAGGCCTCTTCTTTCTTTGGT
TCCCAAGGCTGGTACCTTGTCCAGTCCCTTTGCCCTGGGTTCAGAGCATGCCCCTTGGAGTGGTAGATCAAGTCGTCACCCTGTCCGGTGTAGTTCTGTC
TGTGCTCCCTAATGAACTTTTTAGTCTTCTCCTCCAGCAGCTTGTCCCCAGTGCTGTCTGTAATGTGGTGCAGCCATCCATGCCATTCAGCAGGCACTTG
GGATGCATTGTAGCGACCCTTGTCCGCATACTCTACCCACCTATGCCTTCCATACTGAGTGTCATGTAGTTTCTCATAGTACTTGTTTCCAAAAGTGTCA
ACTCCTACAAGGGTTGCACCAATGTTGTGAATTTTGGTTTGCAATAGGTTTCCGTCCCCAAGGCATTTTAGGTATCCCTCTTCGCGGGCGTAGCGGAGGA
AGTTGGTGAGGCCCTTCTCCCTGATCCCCTGCCACACGCTCCGGACCACCGCGGCCATGGATGATGCCTTCGCCTCCTCCGCCGCTCTCCCTTCGTTTCC
TCTCAATGGCCGATGCGATGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAAGTATGAACCAATTTGAACTGTGAAACTGCGAATG
GCTCATTAAATCAGTTATAGTTTGTTTGATGGTACGTGCTACTCGGATAACCGTAGTAATTCTAGAGCTAATACGTGCAACAAACCCCGACTTCTGGGAG
GGGCGCATTTATTAGATAAAAGGCTGACGCGGGCTCTGCTCGCTGATCCGATGATTCATGATAACTCGACGGATCGCACGGCCTTCGTGCCGGCGACGCA
TCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGGGGCCTACCATGGTGGTGACGGGTGACGGAGAATTAGGGTTCGATTCCGGAGAGGGAG
CCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCTGACACGGGGAGGTAGTGACAATAAATAACAATACCGGGCGCA
TTAGTGTCTGGTAATTGGAATGAGTACAATCTAAATCCCTTAACGAGGATCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAA
TAGCGTATATTTAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGGACCTTGGGCCGGGTCGGCCGGTCCGCCTCACGGCGAGCACCGACCTACTCGACCCTT
CGGCCGGCATCGCGCTCCTAGCCTTAATTGGCCGGGTCGTGTTTCCGGCATCGTTACTTTGAAGAAATTAGAGTGCTCAAAGCAAGCCATCGCTCTGGAT
ACATTAGCATGGGATAACATCATAGGATTCCGGTCCTATTGTGTTGGCCTTCGGGATCGGAGTAATGATTAATAGGGACAGTCGGGGGCATTCGTATTTC
ATAGTCAGAGGTGAAATTCTTGGATTTATGAAAGACGAACAACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAAGAACGAAAGTTGGGGGCTCG
AAGACGATCAGATACCGTCCTGCCCCTCCTCCAGGAACTCGCGGATTGCTTGGTGCTCCCGCCCAAATTCCTGTCCCTGCTGCCCCGCGACCTCCGCCTC
GATCTCAATGACGCGGCATTCGATCTCTCCAACGGGCCTGTTCTCAACGAGTGTGGCCAAGAAGTCGGTGATCTGCTGCTGGACCTGGGAAAAGCATGGG
AGATGGCTAACACAGAAGCATCAAATAACCTTGCCAAGCAGCTGCCGTCAATGGCGCCCTACTTGACTGCCAGCGCGAAATCAGCATTTGGCAAGCGGCT
GGCATCAGCTGGAAAGAAGTTTCAGACCATGGGGCAGTATGGCAATGGAGAGTTCAAGAAGATTTCTGAAACAATGATCAAGATCGGTAAGGTTCTATCG
AAACGCCCAGTGATTCAAGCTGAAGTAGAGGCCACGAAAGAAAAACGAAAGCTAAAGTTTGCAGGAGCTGAATTCGAATTGACAGCGCAAAATGCATACA
TCGGTGCTGCAGTTGGACTGGTTTTCGGGTTTTTCTCCTGGCAGCTGGCCCAAGGCGTGCAAAGCAGTCCAGACGACAGCCAGCCGCTCAAGGTCCCGCT
GCTGCTTCTCGGCTACACTTCGACGGCCCTGTCCGCGGCCGCGGCGGTGGGGCTCGTGGTGCTGGCCCTGCAGATGAACCCCGAGGACAAATCGGACTAA
CTGAACTGTCTTTTAGTTTCTCTTTTTCTTGAGCTGGAACTGCCTTTTTCAGTTCCTGAAAACCGCTGAGCTCGCGCGGCGCCTTAACCCCCCCTGGAAG
ACTGTAAAAACCTGCAATGCTACCTTGAGTTAACTATAAAATCTGTTTGCCCTCAAAAAAAAAAAAAAAAANCNCNAAAAAAAAA
page-top