Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig1601
Contig Information
Length 835 bp
Tissue Shoot grown under cold condition for 16days
Clones 7 Clones [Download: CSV  ,  FASTA ]
whv16n2j11    whv16n4m08    whv16n5f02    whv16n19a21    rwhv16n2j11    rwhv16n4m08    rwhv16n19a21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Ribulose bisphosphate carboxylase small chain PWS4.3, chloroplastic; Short=RuBisCO small subunit PWS4.3; Flags: Precursor >gi|170769|gb|AAA34301.1| ribulose-1,5-bisphosphate carboxylase/oxygenase
Score 800
Evalue 1.84419e-83
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig1601
TCCTCCAGATAATACATTACCATGGCCCCCGCCGTGATGGCTTCCTCGGCTACCACCGTCGCACCCTTCCAGGGGCTCAAGTCCACAGCCGGTCTCCCCG
TCGGCCGCCGCTCCAGCGGCAGCCTCAGCAGCGTCAGCAATGGCGGAAGGATCAGGTGCATGCAGGTGTGGCCAATTGAGGGCATCAAGAAGTTCGAGAC
CCTGTCTTACCTGCCACCCCTATCCACGGAGGCCCTCCTGAAACAGGTCGACTACCTGATCCGCTCAAAGTGGGTGCCCTGCCTCGAGTTCAGCAAGGTT
GGCTTCGTCTTCCGTGAGCACAACAGCTCCCCCGGGTACTACGACGGCCGATACTGGACAATGTGGAAGCTGCCTATGTTCGGGTGCACTGACGCCACAC
AGGTGCTGAACGAGGTGGAGGAGGTCAAGAAGGAGTACCCTGACGCCTATGTCCGTGTCATCGGCTTCGACAACCTGCGCCAGGTGCAGTGCGTCAGCTT
CATCGCCTTTAGGCCACCGGGTTGCGAGGAGTCCGGCAAGGCCTAAACTACGAGTTGAAACAATGGCCTATCTCGTATGAAGGTCTTTTGTGAACTTCAC
TTTTGTCCAAAACTCTGCTGTACGACTCTGCTTTCTGACCGGAGCATACCTTTTGTTCTATATGATTTTGTGTATGTATGTACGAACATAGGTTCTTGAG
CATGCATACGTAATTCCTCATAGGTCTATATGCACCGGCTACACATATGCAAAACCTGTGTAATATTTATTATATACAACACGCGGACCATTGTCTTGCT
GTTATTAATTCATGGAAAAAGTTTCTTTATTTGGC
page-top