Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig1574
Contig Information
Length 1283 bp
Tissue Shoot grown under cold condition for 16days
Clones 6 Clones [Download: CSV  ,  FASTA ]
whv16n9g22    whv16n9i22    whv16n12h02    rwhv16n9g22    rwhv16n9i22    rwhv16n12h02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Phosphoglycerate kinase, chloroplastic; Flags: Precursor >gi|21833|emb|CAA33303.1| unnamed protein product [Triticum aestivum] >gi|3293043|emb|CAA51931.1| phosphoglycerate kinase [Triticum aestivum]
Score 1804
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig1574
TCACGTGCCGCTCGACGACAACCAGAACATCACCGACGACACCCGCATCCGCGCCGCCATCCCCACCATCAAGTACCTTCTCAGCAACGGCGCCAAGGTC
ATCCTCACCAGCCACTTGGGTCGTCCTAAGGGTGTTACTCCTAAGTTTAGCTTGGCTCCCCTTGTGCCACGATTATCTGAGCTTCTTGGCATTGCGGTGA
AAAAAGCAGAAGATGTTATCGGCCCAGAAGTTGAAAAATTGGTGGCTGACCTGGAAAATGGTGCTGTTTTGCTCCTGGAAAACGTAAGATTTTACAAGGA
AGAGGAGAAGAATGACCCAGAGTTTGCAAAGAAGCTTGCATCACTGGCAGATCTGTTTGTAAACGATGCATTCGGAACAGCCCACAGAGCACATGCCTCG
ACTGAGGGAGTTACCAAGTTCTTGAAGCCTTCTGTTGCTGGATTCCTTTTGCAGAAGGAACTTGACTACCTGGATGGAGCTGTTTCAAACCCTAAGCGCC
CATTCGCTGCCATTGTGGGTGGCTCAAAGGTGTCGTCCAAGATTGGGGTTATCGAATCCCTGTTGGAGAAGTGTGATATCCTTCTTTTGGGTGGTGGTAT
GATCTTCACATTTTACAAGGCACAAGGACTCTCAGTTGGTTCTTCCTTGGTTGAGGAAGATAAACTTGAGCTGGCAACATCTCTCCTTGCAAAGGCAAAG
GCAAAGGGTGTCTCCCTTCTGTTGCCATCTGACGTTATCATTGCTGATAAGTTTGCTCCTGATGCTAACAGTCAGACCGTCCCTGCATCTGCAATTCCTG
ATGGTTGGATGGGGCTGGACATTGGCCCAGATTCAGTCAAAACATTTAATGATGCCCTGGACACAACACAGACAATCATTTGGAACGGACCAATGGGTGT
CTTTGAATTTGACAAGTTTGCAGTAGGAACTGAGTCTATTGCAAAGAAGTTGGCCGAGCTTAGCAAAAAGGGCGTTACAACTATCATTGGAGGCGGAGAC
TCCGTTGCGGCTGTTGAGAAGGTGGGAGTGGCTGATGTTATGAGCCACATCTCAACTGGTGGTGGCGCCAGCTTGGAGTTGTTGGAAGGAAAGGAGCTTC
CTGGAGTCGTTGCACTTGATGAAGGTGTCATGACGAGGTCGGTGTCCGTATGAGGCTAAGCTTCATTTTGTCGCATCTTAATTCCTTTCATGTACCGTTT
TAAACCTGCCATGTTGTCCTCCCTCTTTTGCTCGTCTTCAACCACTCGAAATGTAAGAGACCAATGTTTTATAGAGAAATACT
page-top