Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig1540
Contig Information
Length 608 bp
Tissue Shoot grown under cold condition for 16days
Clones 6 Clones [Download: CSV  ,  FASTA ]
whv16n7n05    whv16n14p20    whv16n16a14    whv16n16b01    rwhv16n14p20    rwhv16n16a14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit chopper chaperone [Hordeum vulgare subsp. vulgare]
Score 346
Evalue 4.24753e-31
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig1540
GGCATCATCAAACTCTCCCTCCGACGACATCGATCCCCGTCTCCCGATCTTCTCCTCCTGACTCCTGCTGTAGCTGCCAGCCATGGCCTCCGAGACTGTT
GTCCTCAAGGTGGCAATGTCCTGCGGAGGTTGCTCGGGGGCGGTTAAAAGGGTGCTCACCAAAATGGAAGGCGTCGAGAGCTTCGACATAGACATGGAGC
AGCAGAAGGTGACCGTGAAGGGCAACGTCAAGCCAGAAGACGTTTTCCAGACGGTCTCCAAGACCGGGAAGAAGACCGCCTTCTGGGAGGCCGAAGCCAC
TCCTGTACCGGAGGCTACCCCGGCAGCCGACGCCGTGCCTGCACCTGAGGCAACCCCGGCAGCAGACGCCGCGCCTGCACCGGAGGTGACCCCGGCCAAC
ACCGTCGCTTGATGACCACGCACAGATGATGCCGCCGTGACCTTTGAAAACTCCAAGATATTGTTGTTGAGAGAGTCATGGCGGTTTGCACGATGTTACT
TACGAGTTGACTACAACGTAATGGAATAAACAAAGTGTGTATGATCTAGACAAATGAACACGTCGACCACATGATTTACAATAGATTTCAGTTCTATTAA
AAAAAAAA
page-top