Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig1405
Contig Information
Length 737 bp
Tissue Shoot grown under cold condition for 16days
Clones 5 Clones [Download: CSV  ,  FASTA ]
whv16n4e08    whv16n4e19    rwhv16n4e08    rwhv16n4e19    rwhv16n13f17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_19907 [Oryza sativa Indica Group]
Score 842
Evalue 8.72503e-90
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig1405
TTTTTTTTTTATGAAAACACAAGTTCCATATTATTAAAAACGATGTTCGATATCCGAGGATATATCAGGACTCAGGAAACCAAACAATGACAATGATACT
GGTAAGCGGGACGCCCAAACGGGCCACAGCACCGAAGGCAGATCAATCAGTACTTGTAGTCCTTGACGTGGAGGCTCTCGGAGGCGCCCTCAGCGAGGGT
CTCCTCACTCTGTCCACCAGAGAGGAAGACAATGGCGGGGACGGCAGCAGGGACGGTCCTCTGGAGGGTGCGGACGGTGTACTCAGCAATCACCTCAGGG
GCCACCTTCTTGGAGTCAGAACCAGGGGTGACCATGTTGGGCTTCAGGAGAGTGCCCTCGAGGAGGACATGCTGGTCGTTGAGGGCCTTATAGCAGGCAG
CAAGGACGATCTCGGTGACGTAAGCACAGCGGTCAATGTCATGAGGTCCATCAACAAGGATCTCAGGCTCCACAATGGGCACCAGACCATTCTCCTGGCA
GATGATGGCATAGCGAGCCAGACCCTGAGCGTTCTGGTCGATGGAGAGCTGCGATGGCTCGGTGGCGCCGATCTTGAGGACTGCACGCCACTTGGCGAAG
CGGGCACCAGCCTCATAGTACTTGGCGCAGCGCTTGCCAAGGTCATCAAAGCCCTGGGTGGTGGTCTCACCGTTGGTTCCAGCAAGCTCAATGGTACCCT
TGTCCACCTTGATGCCAGGGAGGACATTGCCCGCCTG
page-top