Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig1327
Contig Information
Length 842 bp
Tissue Shoot grown under cold condition for 16days
Clones 4 Clones [Download: CSV  ,  FASTA ]
whv16n3b01    whv16n4m20    rwhv16n3b01    rwhv16n4m20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal subunit 8E protein [Brachypodium sylvaticum]
Score 841
Evalue 3.29255e-88
Total Hit Count 438
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig1327
GAAGCAGCAGCGGAGCCAAGCCACCGACGCCACCCATGGGTATCTCGCGTGACTCCATGCACAAGCGCCGGGCCACCGGTGGGAAGCAGAAGGCGTGGAG
GAAGAAGCGAAAGTATGAGCTCGGCCGCCAGCCAGCCAACACTAAGCTTTCGAGCAACAAGACAGTGAGGAGGGTCCGTGTTCGCGGAGGTAACGTGAAG
TGGAGGGCTCTCCGTCTGGACACTGGTAACTTCTCATGGGGTAGTGAGGCTGTGACCCGCAAGACCCGTCTCCTGGATGTGGTTTACAATTCGTCAAACA
ATGAGCTTGTGAGGACTCAGACCCTTGTCAAGAATGCCATTGTGCAAGTTGATGCTGCCCCTTTCAAGCAGTGGTACCTGACTCATTATGGAGTGGAAAT
CGGTAGGAAGAAGAAAGCTGCTGCAGCTGCCAAGAAGGATGCTGCTGAGGGACAAGAGTCTGAGGTTGCTGCTGCTGCCACAGAGGAAGCAAAGAAGAGC
AACAATGTCCAGAGGAAGCTTGAGAAGCGCCAGCAGGGACGTACACTGGACTCTCACATTGAGGAGCAGTTCAGCGGTGGAAGGCTGCTGGCCTGCATTT
CGTCTCGCCCTGGACAGTGTGGCAGAGCTGATGGGTACATCCTGGAGGGCAAGGAGCTGGAGTTCTACATGAGGAAGCTCCAGAAGAAGAAGGGCAAGGG
TGCCACAGCTTAGGCTGAAGAGCTGCTGCATGTTACTTGTTGGATTTTCTTAGATGTTGCGTCCATGTCATGTTTGCAGACATACTGAACACCATTTTCT
GTAAACTGTTCGAGTCCTAGGTTGAACTGAGAATGTTTTTCC
page-top