Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig1199
Contig Information
Length 1075 bp
Tissue Shoot grown under cold condition for 16days
Clones 4 Clones [Download: CSV  ,  FASTA ]
whv16n14i07    whv16n16h16    rwhv16n14i07    rwhv16n16h16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein L10A [Triticum aestivum]
Score 994
Evalue 8.89185e-106
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig1199
ATCCGGCGTCAACTGATCGGCGGCAGCCATGAGTAAGCTCCAAAGTGACGCTGTTAAGGATGCCATCACCCAGATTGTTGGGGAGGCGAGAGAAAAGAAG
CGCAAGTTCACTGAGACTGTGGAGCTTCAGATCGGTCTCAAAAACTACGACCCACAAAAGGACAAACGTTTCAGCGGCTCAGTGAAGCTGCCCCATATCC
CCCGCCCAAAGATGAGGGTGTGCATGCTTGGTGATGCCCAGCATGTCGACCAGGCTGAGAAAATGGGACTTGACTACATGGATGTTGAAAGTCTCAAGAA
GATGAACAAGAACAAGAAGCTTGTTAAGAAGCTAGCCAAGAAGTACCATGCTTTCTTGGCATCAGAGGCCATAATCAAGCAGATCCCTCGTCTCCTTGGC
CCTGGTCTTAACAAGGCAGGCAAGTTTCCCACTCTGGTTAGTCACCAGGAATCTCTTGAAGCCAAGGTCAACGAGACAAAAGCTACAGTCAAGTTCCAGC
TAAAGAAGGTTCTTTGCATGGGTGTTGCTGTGGGCAACTTGTCGATGGACGAGAAGCAGATCCAACAAAACATCCAAATGAGTGTCAACTTCCTTGTGTC
CCTCCTGAAGAAGAATTGGCAGAATGTGAGGTGCCTGTACGTGAAGAGCACCATGGGGAAGCGTGTACGGGTGTTCTAAGTGTGTGCGCTCCAGTGAAGT
TGATAAGATACTGGGCTGTCCTGCCGACCCCTGCTTGTCTTTGGATTAGATCTGTTTCACTGATACCAATTTTCTGTTTGCCTAAGCGAATATCAACAAG
TATTTTATCGTACTAGTCTTATCTTGAACAGAAATCATGGGAGCAATGGAACTGCATTTTCTGTCATGATTCTGCGTTGTGCCTGTTATCAGAGATCTAT
ATGCGATCTTGATTGTCATCTGAATGTAGATTTTACTTGGAAGTGTTTCCTATAAGTGTGTTTAAATGGATAACTTATTTGGTTAGCCTAGCAAATCTCA
GGAAAATAGAAGTTTGTTATCTGTAAAACCGGAGAAGTGGGATTTTGTAAAAACGACTGTCAGTACTATATGCTT
page-top