Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig1167
Contig Information
Length 1608 bp
Tissue Shoot grown under cold condition for 16days
Clones 4 Clones [Download: CSV  ,  FASTA ]
whv16n2h07    whv16n12i19    rwhv16n2h07    rwhv16n12i19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit conserved hypothetical protein [Aurantimonas sp. SI85-9A1] >gi|90336396|gb|EAS50137.1| conserved hypothetical protein [Aurantimonas sp. SI85-9A1]
Score 404
Evalue 7.7353e-44
Total Hit Count 249
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig1167
AGTCCTCGCCTTTTTCATCTTCCGTAGGGGCCTTTAGTCTTTTGATTAGAGTGGAGGTCGCGAGAGAGCAGAGCGTACCGCCCTGCCATAGTCGCGAGGA
TCTTAATAGTCGGTCGCGACTGTTGTCATAGTCAACGACGGTTGAAACTTCCAGGAAAAAAACTTCGAATTGGGAGGGCGATCCTCCCGGTGAACTGACC
GTACCCCAAACCGACACAGGTGAACAAGTAGAGTATACTAGGGCGCGTCGAGAGAACCATGTCGAAGGAACTCGGCAAAATGACCCCGTAACTTCGGGAG
AAGGGGTGCTCTCCTATCTTTTGATTAGGAAAGCGGCACATACCAGGGGGTAGCGACTGTTTATTAAAAACACAGGACTCTGCTAAGTGGTAACACGATG
TATAGAGTCTGACACCTGCCCGGTGCTGGAAGGTCGGAAGGAGAAGTGTGATAAGCTTTGAATGGAAGCCCCGGTAAACGGCGGCAGTAACTCTAACTGT
CCTAAGGTAGCGAAATTCCTTGTCGCATAAGTAGCGACCTGCACGAATGGTGTAACGACTGCCCCGCTGTCTCCGACATGGACCCGGTGAAATTGAATTC
TCCGTGAAGATGCGGAGTACCAACGGCTAGACGGTAAGACCCCGTGCACCTTGACTATAGCTTCGCAGTGACAACCTTGATCGAATGTGTAGGATAGGTG
GGAGGTGGTGACACACAACGACCAATCCTGAAAGACCACTCTTTCGTCTAAGGATGCCTAACCGCCGCACCGATCATTCGGGGGGGGCGGGACACTGCGA
GGTGGGTAGTTTATCTGGGGCGGATGCCTCCTAAAGAGTAACGGAGGTGTGCGAAGGTAGGCTCAAGCGTTGATTCTGCTCGTGAGCGTAATGGTATAAG
CCTGCCTGACTGTGAGACCGACTGGTCGAACAGAGACGAAAGTCGGCCATAGTGATCCGGGAGTCCCGTGTGGAAGGGCTCTCGCTCAACGGATCAAAGG
TACGCCGGGGATAACAGGCTGATGACTCCCAAGAGCTCTTATCGACGGAGTCGTTTGGCACCTCGATGTCGACTCATCACATCCTGGGGTTGAAGAAGGT
CCCAAGGGTTCGGTTGTTCGCCGATGAAAGTGGTACGTGAGTTGGGTTTAGAACGTCGTGAGACAGTTCGGTTCCTATCTACCGTTGGTGTTAAAGGGAG
AACTGCGAGGAGCCAGCCCTAGTACGAGAGGACTGGGCTGGGTCAACCTATGGTGTACCGGTTGTTATGCCAATAGCAGCGCCGGGCAGCTAAGTTGGTA
TGGAAGAACTGCTGCGCCGCGGGAAATCCTTCTCTATACAAGTTCTCGTACGAGGTTTTTGAACAGAACCGGCACGAGGGCAGCTGCCACCGCGTAATCT
TCTGATGATGACGATCCTGGTGTGTGAAACAGTGTGAAGTTATCATGCTTCCTGTAGGAGGGAAGCATGCTTGCTTCTAAATCCCTCATGTACTGTATAT
ATTCTCCTCAAATGCCACCTTCTCCTGTATCCTCTGTACCCCCCACGGCCCCCACTGCCTCCCCATTCCCATTTGAAAGTGAAATTAGCTATATTGGCTA
GCATTCCA
page-top