Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig41
Contig Information
Length 499 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl52p07    whfl8n07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit dihydroflavonol-4-reductase [Zea mays]
Score 628
Evalue 4.90168e-64
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig41
atGCGTTGATGTGTCAAATTTCAGGAGCACTTCCAGCTTCAGAGAATGGCGAATACTTCCAAGGGCAAGGTGTGCGTCACTGGAGCCTCTGGCTTTGTTG
CCTCTTGGCTTGTCAAGCGACTTCTTGAGTCAGGGTATCATGTTCTAGGGACAGTCAGAGACCCAGGCAATCAGAAGAAGGTAGCACACCTCTGGAACTT
AGCAGGTGCTAAGGAGAGGCTGGAGCTCGTGAGGGCTGACCTCTTGGAAGAAGGGAGCTTCGACGATGCTGTGATGGCCTGCGAGGGCGTCTTCCACACT
GCATCGCCTATCATCACCAATGCTGATTCCAGGGAAGAAATGCTTGATTCAGCAATAAACGGCACTCTAAACGTGCTGAGATCCTGCAAGAAGAACCCAT
TTCTCAAAAGGGTTGTCCTCACGTCGTCATCGTCgaccgtgaggctgagagatgaagctgaattcccccccaacgtgctattggatgaaacatcatgga
page-top