Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig712
Contig Information
Length 920 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n17a23    rwhv16n17a23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_006100 [Oryza sativa (japonica cultivar-group)]
Score 1126
Evalue 3.43593e-121
Total Hit Count 493
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig712
AGGGGAGGAAGGGTAGCAAAAAGAAGGCCGTCGATCCGTTCACCAAGAAGCAGTGGTATGACATCAAGGCGCCGCTGCTGTTCACCANCCGCAACGTCGG
CAAGACCCTCGTGTCCAGGACACAGGGTACCAAGATTGCCTCAGAGGGTCTGAAGCACAGGGTGTTCGAAGTATCTCTAGCTGATCTTCAGAACGATGAG
GACCAGGCCTACAGGAAGATCAGACTCCGTGCTGAGGATGTGCAAGGGATTAATGTCCTCACAAACTTCTGGGGCATGGACTTCACCACTGACAAGCTCA
GGTCTCTTGTGAGGAAGTGGCAGACACTCATTGAGGCTCATGTGGATGTGAAGACCACTGACAACTACATGCTCCGCATGTTCACCATTGGCTTCACGAA
GAGACGCCCAAACCAGGTGAAGCGCACTTGCTATGCCCAAGCAAGTCAGATCAGACAGATCCGCCGCAAGATGGTTGAGATCATGGTCAACCAAGCTGCA
AGCTGTGACTTGAAGGAGCTTGTGAACAAGTTCATCCCTGANGTGATTGGAAAGGAGATTGAGAAGGCCACCTCAAGCATCTTCCCCCTCCAGAACGTGT
ACGTCCGCAAGGTGAAGATCCTGAAGGCCCCCAAGTTTGACCTGGGGAAGCTCATGGAGGTGCACGGTGACTACAAGGAGGATGTTGGTGTGAAGCTTGA
CAGGCCTGCTGATGGAGATGAGGTGATTCCTGGAGCGGAGGAGGTTGCTGCTGCTGAGTAGAAAATAGAAGTCGCTATTTTGCTGCTTCATATCTAGAAG
ATGATATATGTGCCACCTGGGTGTCGTGAACTTTGTAGTCAGTTTTGATGGCTGATTTCTTGAGTACTTCTGTCGACATTCCTAGCCAGCGTTCAGTTAT
CTTATTTTGTTACGTGTTAC
page-top