Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig92
Contig Information
Length 752 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n12o24    rwhv16n12o24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Plasmodium falciparum 3D7] >gi|23496272|gb|AAN35930.1|AE014841_13 hypothetical protein PF11_0346 [Plasmodium falciparum 3D7]
Score 88
Evalue 0.548893
Total Hit Count 5
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig92
GTTAATTTCAAAGAAACAGAGGGGCTTTTTCGCAAAAACACCGACGACGTACGACCAGAAGCACTCCGTGCTTTATTAGTACTAGCAAAAGGGCCCGTGC
GTTGCAACGGGAGAAAAAAATTCATAATTTCAAATGGTCATGATCACATTTCGTTGCATCACCGAGATACAATATCTCTCTCAATTTCTCGAAATCATAA
ACATTTTGAAATTATGAACAATTTGTTAAACTCATGCACATATTTGAAATCGCAAACAACATACTATTACAAATTTCTGAACATTTTCTACAATCAAGAA
CATTTTTTCAATTTATGAATATTTTTTGCTATTTACAAACATTTTTTAAAAATTGTGAACATTTTTAAGCAATTTTCCTGAACTGGCAAACATTCTATAA
TCGATGAAAATATTTAGAAATTGGGTGGAATAGTTATTGAATTTGACGAACTTTTTTTGATTTAGCGAACATTTTTGGAAATGCCCGTGCCTTGCAACGG
AAAAAAACTATCAAGTTATACATGTGTGGTAGATATAAAAAAGTATGAATCAAATTCACAAAGTATATACAAATCATGTCATGATGCGATAAGACACTTT
TAAAATGTAATTTCAAAAACGAACAATATGATGCTCATCAAGACTTGATTTTTTAAGGCGTCACAACAAAATATTTTGTGGCTGAGCAAACTGCATTGAC
GGACCCTGTCTGAGCTATACTGATAAATAAAGTGTCTCGTCTGGAAAAAAAA
page-top