Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig88
Contig Information
Length 923 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n2h04    rwhv16n2h04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_07725 [Oryza sativa Indica Group]
Score 624
Evalue 5.60774e-63
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig88
CCTCCCCCTCCCCACCACCTCCGGCCGCTCCCTTCCGCCCCGCGCCACCACCACCACCACCCTCCCCTTCCCAAGATCCCCACTGCGTCTCCGCCGCCGC
CGCCAGATCCGCGTCTCCGTGTCGTCGTCGTCGTCGTCGGAGAGCAACGAGGAGGGCGCGGGGAGCACCAACGGGTCCCTGCCGGGGCTTGCCCCCGTGA
ACGGCGAGGAGGAGGAGGAGGAGGAGGACGAGTCGTGCCCGGTGGAGTGCGTGACGGAGTTCAAGACGGACGAGGAGCTGGGGCGGTTCCTGGAGCGGTC
GCGGGCGACGGGCGCGCTGGTGGTGGTGGACTTCTTCCGGCCCTCCTGCGGCAGCTGCAAGTACATCGAGCAGGGCTTCATGAAGCTCTGCAAGGGCTCC
GGCGACCACGGCTCCCCCGTCATCTTCCTCAAGCACAACGTGATTGATGAGTACGACGAGCAGTCGGAGGTGGCGGAGCGGCTGCGCATCAAGGTGGTGC
CGCTCTTCCATTTCTACAAGGCCGGGGTCCTGGTCGAGTCCTTCGCCACCCGGGACAAGGACAGGATCACCGCCGCCATTGCCAAGTACACCTCACCTGA
TGAGCAGGAGCCGGAGACGCAGCCGGAGGAGTAATTTCTACTCCAAATACGTACATACATCAAGAGCCATCTAGCTAGACTGGTAACCGAGTGATCTGCC
AAAGCTAGCTAGCTTGCTAAATGAACCTCCATTGTAGCAGGAAAAAACTGGGATTGGTTGTAATAATAAAGCAGAGTATATCATGATTCATGAAATAGTT
GTATGCATGCAAAGGGATCCATGTAGAATGGTCGAGGATAGATCCTGGTTGATTACTCAATGTCATTTCCGATCCAGTGACTCCCCGTTGCAAAGTTTCA
GACTTTGACCTGATCATTCAACA
page-top